need help! The horizontal and vertical lines on a graph. The x is horizontal and the y is vertical.

Need Help! The Horizontal And Vertical Lines On A Graph. The X Is Horizontal And The Y Is Vertical.

Answers

Answer 1

Answer:

X is horizantal and Y is vertical

Explanation:

Answer 2

Answer:

la respuesta es axis creo


Related Questions

dead cells are removed from the Dermis by phagocytosis. true or false?​

Answers

The answer to your question is false I think.

This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism

Answers

Answer:

A. Mutualism

Explanation:

The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.

A.Mutualism. hshshshshs

In protein synthesis, how many nitrogenous bases code for a single amino acid?
one
two
three
four

Answers

3 nitrogenous bases code a single amino acid.

Answer:

C

Explanation:

EDGE 2022

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 -  Sensory neurons carry stimulus information to the brain or spinal cord.

3 -  The brain processes the information through interneurons.

4 -  Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

30. Which of the following best explains why enzymes are necessary for many cellular reactions?
A. Enzymes supply the oxygen necessary for the reactions.
B. Enzymes change reactants from solid to liquids during the reactions.
C. The reactions take up too much space in the cell if the enzymes are missing.
D. The reactions are too slow to meet the needs of the cell if enzymes are missing.

Answers

Answer:

D. The reaction are too slow to meet the needs of the cell if enzymes are missing

hope it helps

Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea

Answers

Answer:

Yes.

Explanation:

Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

3 examples of radioactive dating?

Answers

Answer:

Uranium 238

Potassium 40

Rubidium 87

Explanation:

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

How can a person cannot taste PTC I'd both of their parents have the ability to taste PTC?

Answers

Answer:

the parents are (Tt) and each passed down the recessive allele so the child is  (tt)

Explanation:

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

Which process begins the formation of sedimentary rock?

Answers

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock. ... Sediment can be moved by wind, running water, ice, or waves.

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

What is the relationship between the rock cycle and the plate tectonics?

Answers

Answer: The metamorphic rocks can erode into sedimentary rocks which can turn into igneous rock. Metamorphic rocks in the rock cycle is driven by tectonic plates.

Explanation:

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

In the mouse model of malaria, the researchers injected Plasmodium-infected human red blood cells into the mice because the Plasmodium species had surface ligand proteins that bound only to cell membrane proteins of human red blood cells. Assume that the researchers noticed that some of the parasites no longer infected human red blood cells but instead infected mouse red blood cells. Predict the most likely cause of this change in the host specificity of the parasites. Plasmodium reproduces both sexually in the host vertebrate and asexually in mosquitoes. The researchers claim that the Plasmodium organisms that infect the two different types of red blood cells are likely to evolve into two separate species of Plasmodium. Based on the biological species concept, provide reasoning that would support the researchers’ claim.

Answers

There is a mutation in the în the genes coding the ligand. They will evolv3 separately in two host species proving the researchers right.

Which of the following is a molecule with more than one element?
O Atom
O Bacteria
O Compound
Organism

Answers

Answer:

compound

Explanation:

as cited from coolgalapagos.com, "Molecules made of more than one kind of element are called compounds. A compound is formed when one kind of atom (an element) joins to at least one other kind of atom of a different element."

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars

Answers

Answer:

b

Explanation:

Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.

The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.  

Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:

DNA is the genetic material of the cell  DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formation  

Thus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.  

Learn more about DNA here:

https://brainly.com/question/264225

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

Thank you to anyone who answers .

Answers

Answer:

D

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

Bill Nye Earth's crust

Answers

1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust

Answer:

1. rock

2. on

3. mantle

4. volcanoes

5. active

6. lava

7. hot

8. coolest

9. geyser

10. resistant

11. tectonic

12. tectonic/pangea

13. caves

14. earthquake

15. crust

Explanation:

what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?

Answers

the answer is hematopoiesis

help-- multiple choice!
Biogenic sediment is made of at least 30 percent...

acidic chemicals

alkaline properties

limestone or other rock

skeletal remains

Answers

Answer:

The answer is the last one, skeletal remains

Answer: Skeletal remains

Earth science question. Please help

Answers

Answer:

answer choice 4, more rain and a steeper slope cause it to flow faster

Explanation:

People who have leukemia, cancer that affects white blood cells, are often given Cytarabine. This drug inhibits the synthesis of DNA. Which phase of the cell cycle is most affected by Cytarabine?

Answers

Correct answer is S phase. cytosine into cytosine arabinoside triphosphate is what makes the answer S phase.
Other Questions
Can someone tell me if its correct Ayer,el presidente Obama conmemorar el nacimiento de Cesar Chavez quien dedico su vida a los derechos de los campesinos HELP!Eric bought 16 ounces of coffee beans for$14.40. At this rate, how much would 11 ouncesof coffee beans cost? Black fur (B) is dominant and white fur (b) is recessive in mice. What are the possible offspring of two black mice (Father = Bb and Mother = Bb) bred together? Think of Mendel's F2 generation. Where will the two lines intersect? y=2x+1 and y=-2x+5 Planetesmals are made from HELPPPPP ME PLS lol lol lol lol A lens 57.8 cm from an objectforms an image 38.5 cm from thelens. What is the focal length ofthe lens? The test: To understand if the ACTN3 protein affects running ability, researchers conducted a test. They recruited a group of competitive runners and measured the level of ACTN3 protein molecules each runner had in their bodies. Then, they had the runners participate in a sprint (a short-distance run). During the test, the runners sprinted as fast as they could for 100 meters.Evidence: Scientists found that the runners who sprinted the fastest had the highest amount of ACTN3 protein molecules in their bodies.Do you think that this evidence shows that the ACTN3 protein determines running ability? Explain your ideas using the words protein, trait, and feature in your response. 22 and 21 please help no links or i report The Frostburg-Truth bus travels from Frostburg Mall through the city's center to Sojourner Truth Park. The mall is 4 miles east and 5 miles north of the city's center. Truth Park is 4 miles west and 2 miles south of the city's center. How far is it from Truth Park to the mall to the nearest tenth of a mile? A-10.6 B-4.5 C-3 D-6.4 please help! i'll give brainliest! no one would help me PLEASE. Please help I'll mark brainliest PLEASE HELP ME I'M BEING TIMED!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! HURY HELP ME ASAP!!!!!!!!!!!!!In the Jamaica Letter written by Simon Bolivar, he commented that the only acceptable form of government for the colonies of Latin America was a Republic and that in no way should a paternalistic authoritarian government be accepted.True/False Will give brainliest! Please help Which sentence uses a passive form of the verb justify?A )Trevon's mother justified her son's actions by referring to his morals.B )Celia felt justified in missing class to help someone in need.C ) Kevin had justified his misconduct with half-truths.D ) Samantha's lack of civility was justified by Willem's rudeness. The area of a rectangular patio is 3x2 + 17x + 20 ftWhich of the following could be dimensions of the patio?O A. X+ 5 ft by 3x + 4 ftB. 3x + 5 ft by x + 4 ftOC. X + 5 ft by x + 4 ftO D. 3x + 5 ft by 3x + 4 ft Hello! could someone please do a 4 sentence quark poem Find the equation of the line that passes through (5, 12) and has a slope of -6 Name the 4 bases found in DNA.