P deceased by the total of q and r

Answers

Answer 1

Answer:

P deceased by the total of q and r

Answer 2

Answer:

The answer is: p-(q+r)

Hope that helps. I just did it on my test and I got it right :D


Related Questions

What number is a square root of 1 ?

Answers

Answer:

1 is the square root of 1.

Hope that helps! :)

Step-by-step explanation:

how to graph y=2x-4

Answers

Hope this helps!!!!!!

A brick wall will be shaped like a rectangular prism. The wall needs to be 3ft tall and the builders have enough bricks for the wall to have a volume of 330 cubic feet. What tool can be used to find possible dimensions for the base of the wall?

Answers

Answer:

For a rectangular prism that has a base area B, and a height H, the volume is:

V = B*H

This is the only "tool" that we need to use in this situation.

We know that the wall needs to be 3ft tall, then H = 3ft

And we also know that we have enough bricks for a wall of a volume:

V = 330 ft^3

If we replace these two in the volume equation, we get:

330ft^3 = B*3ft

Now we can solve this for B, and thus find the volume of the base of the wall.

To do it, we just need to divide both sides by 3ft

(330 ft^3)/3ft = B*3ft/3ft

110 ft^2 = B

This means that the area of the base is 110ft^2

As the base is a rectangle of width W and length L, we must have:

110ft^2 = B = L*W

Then the possible measures of the base are given by the linear relation:

L = 110ft^2/W

Where we also need to add some trivial restrictions, like:

L > 0 ft

W > 0ft

This only means that we can not have a length or width equal to or smaller than zero, as those do not have physical sense.

Find the volume of the figure

Answers

The correct answer would be 616

1. Solve the compound inequality. You do not need to graph the solution.

Answers

Answer:

9 ≤ x ≤ 7

Step-by-step explanation:

2x – 3 ≤ 11 or –8x – 10 ≤ – 82

We shall determine the value of x in both case.

2x – 3 ≤ 11

Collect like terms

2x ≤ 11 + 3

2x ≤ 14

Divide both side by 2

x ≤ 14/2

x ≤ 7

–8x – 10 ≤ – 82

Collect like terms

–8x ≤ – 82 + 10

–8x ≤ – 72

Divide both side by –8

x ≤ – 72 / –8

x ≥ 9 (since we divided by a negative sign)

9 ≤ x

Combining both answers

x ≤ 7

9 ≤ x

Thus,

9 ≤ x ≤ 7

What is Y= -1/3x + 3

Answers

Answer:

Slope: -1/3  y-intercept: (0,3)  x-intercept: (9,0)

Step-by-step explanation:

the answer of this question is x=9

How to find Gradient and y intercept

Answers

Gradient:

Find two points on the line and with those two points, calculate the difference in height(y coordinates) divided by the difference in width(x coordinates). If you get a positive value, then your line will be uphill.

Y-intercept:

Use y=mx+b
Find the slope first using the slope formula which is y2-y1 OVER x2-x1. Once you have that, take a point from the line and substitute the x and y coordinates along with the slope into y=mx+b.

So if your slope was 2/1 and your point was (4,8), it would be:

8=2(4)+b
8=6+b
*subtract 6 from both sides*
b=2

the graph below is the solution for which set of inequalities

Answers

you didn’t attach a picture of the graph

21 help asap Brailiest pic below

Answers

Answer:

A

Step-by-step explanation:

The inverse is just the opposite it is a flip

Find the volume of the
rectangular prism.
2 cm
8 cm
5 cm
V = [?] cm3

Answers

the answer is 23 + 90 = 80

The volume of a rectangular prism is 80 cm³.

The dimensions of a rectangular prism are length=8 cm, breadth=5 cm and height=2 cm.

What is the formula to find the volume of a rectangular prism?

The formula to find the volume of a rectangular prism is l×b×h.

Now, the volume of a rectangular prism=8×5×2=80 cm³.

Therefore, the volume of a rectangular prism is 80 cm³.

To learn more about a rectangular prism visit:

https://brainly.com/question/21308574.

#SPJ2


I will mark u as brainliest no websites


Answers

Answer:

the independent variable is p and the dependent variable is b

Step-by-step explanation:

Solve for x
4/x = 2/7

Answers

the answer is 14

x=14

Can someone help me ASAP

Answers

the first answer is c

-10 + 4(3b + 10) = 19

And show work, please :)

Answers

Answer:

b= -11/12

Step-by-step explanation:

- 10 + 4(3b+10) = 19

-10 + 12b+40 = 19

40-10+12b=19

30+12b=19

-30          -30

12b= -11

/12     /12

b=  -11/12

Ivan has a sticker collection. 2/5 of his stickers are scratch-and-sniff stickers. 1/4 of his scratch-and-sniff stickers smell like bananas. What fraction of Ivan's sticker collection smells like bananas? *

Answers

Answer:

1 / 10

Step-by-step explanation:

From the question :

Fraction of scratch and sniff sticker from total stickers = 2/5

1/4 of scratch and sniff stickers smell like banana :

Fraction of total stickers that smell like banana :

(Fraction of scratch and sniff sticker from total stickers) * (scratch and sniff stickers smell like banana)

= (2/5) * (1/4)

= 2 /20

= 1/10

what us 3×3+7×7 but I have to find the answer​

Answers

Answer:

58

Step-by-step explanation:

3 * 3 is 9 + 7 * 7 is 49 so 9 + 49 equals 58

Answer:

58

Step-by-step explanation:

Following the Order of Operations, you'd put parenthesis around the two threes and the two sevens, making it (3*3)+(7*7) which equals 9 + 49 and results in the number 58.

Watching your neighbors toddlers for $15/1.5 hours or babysitting your cousins for the day for $60/8 hours. Which one pays more?

Answers

Answer:

.

Step-by-step explanation:

Answer:

Babysitting your cousins

Step-by-step explanation:

Becauss 15/1.5 is 3. And 60/8 is 7.5

The equation A= 1750(1.04)t represents an account balance t years after the account was created. Which statement is correct?
A. The account balance will decrease 0.04% each year.
B. The account balance will increase 0.04% each year.
C. The account balance will decrease 4% each year.
D. The account balance will increase 4% each year.

Answers

Answer:

D. The account balance will increase 4% each year.

Step-by-step explanation:

Given the equation :

A= 1750(1.04)t

This is an exponential growth rate equation which has it's general format as :

A = A0 * (1 + r)^t

A0 = initial value,

Since (1 + r) is greater Than 1 ; then we conclude that it is a growth relation.

1 + r = 1.04

The rate, r = (1.04 - 1) = 0.04

r = 0.04 = (0.04 * 100%) = 4%

Hence, The account balance will increase 4% each year.

Simplify.
(6^2)^4
O 6^6
O 6^8
O 36^4
0 6^2

Answers

Answer:

its b and c dude

Step-by-step explanation:

Answer:

6^8

Step-by-step explanation:

Hope that helped!

Plz, mark brainiest, only 3 more till I level up!

Have a great day!!

PLEASE HELP ASAPPP!!!

Directions: Show all of your work for the following two problems on a seperate sheet of paper. Take a picture of your work and attach the picture to this assignment.

1. Solve the following system of equations, show all your work on a separate sheet of paper, and check your answer. Write the solution as a point (x,y) (4 points).

3x + 5y = -40

–x + 4y = -15?



2. Suppose you and your friends form a band and you want to record a demo. Studio A rents for $125 plus $50 an hour and Studio B rents for $200 and $30 an hour. Let t = the number of hours and c = cost.

Write an equation to represent the cost at each studio (2 points)

Solve the system (2 points)

Write the solution as a point (x, y) (2 points)

Answers

Answer:

x = -5  y = -5

Step-by-step explanation:

–x + 4y = -15

     - 4y  -4y

-1(-x = -4y - 15)

x = 4y + 15

Substitute x = 4y + 15 into 3x + 5y = -40

3(4y + 15) = -40

17y + 45 = -40

      - 45   -45

17y = -85

/ 17    /17

y= -5

Substitute y = - 5 into x = 4y + 15:

x = 4(-5) + 15

x = -20 + 15

x = -5

Answer:

Part I

(-5,-5)

Part II

(3.75, 312.50)

Step-by-step explanation:

Part I

(1) 3x + 5y = -40

(2) -x + 4y = -15

solve for x in (2)

x = 15 + 4y

substitute into (1)

3(15+4y) + 5y = -40

45 +12y + 5y = -40

45 +17y = -40

17y = -85

y = -5

substitute y = -5 into (1)

3x + 5(-5) = -40

3x -25 = -40

3x = -15

x = -5

so  (-5, -5)

Part II

Studio A  

C = 125 + 50t

Studio B

C = 200 + 30t

125 + 50t = 200 + 30t

20t = 75

t = 3.75

(3.75, 312.50)

Given 300mL of a gas at 17.0 degrees Celsius, what is the volume at 10 degrees Celsius if the pressure remains constant?

Answers

Answer:

292.75mL

Step-by-step explanation:

From the ideal gas equation

PV= nRT

With each symbols having standard meaning

For pressure remaining constant the equation for two states can be written as

[tex]\frac{V_1}{T_1}=\frac{V_2}{T_2}[/tex]

Given V_1 = 300mL, T_1 = 17° C = 290K and T_2 = 10°C or 283K

Now plugging values in above equation to find V_2

[tex]\frac{300}{290} =\frac{V_2}{283}\\V_2 =\frac{300}{290}\times283 = 292.75mL[/tex]

Therefore, the volume at 10 degrees Celsius = 292.75mL

becca surveyed the students at her school to find out which cellphone company they use. Her results are listed on the table. What is the probability that a randomly chosen student is a junior who uses company B? ​

Answers

Answer:

would be awesome if u had attached a pic of the graph. we can't help u with this little information

You need a mean of at least 90 points to advance to the next round of the touch-screen trivia. What score in the fifth game will allow you to advance

Answers

Answer:

At least 98 is needed in the 5th game

Step-by-step explanation:

The missing parameters are:

[tex]Game\ 1 = 95[/tex]

[tex]Game\ 2 = 91[/tex]

[tex]Game\ 3 = 77[/tex]

[tex]Game\ 4 =89[/tex]

[tex]Mean = 90[/tex] at least

Required

The score in game 5 to make you advance

Mean is calculated as:

[tex]Mean = \frac{\sum x}{n}[/tex]

So, we have:

[tex]Mean = \frac{95 + 91 + 77 + 89 + Game\ 5}{5}[/tex]

[tex]Mean = \frac{352 + Game\ 5}{5}[/tex]

The mean must be at least 90.

So, we have:

[tex]\frac{352 + Game\ 5}{5} \ge 90[/tex]

Multiply both sides by 5

[tex]5 * \frac{352 + Game\ 5}{5} \ge 90 * 5[/tex]

[tex]352 + Game\ 5 \ge 450[/tex]

Make Game 5 the subject

[tex]Game\ 5 \ge450 - 352[/tex]

[tex]Game\ 5 \ge 98[/tex]

At least 98 is needed in the 5th game

I have a picture with the question plz help I've been stuck on this

Answers

Answer:

i'm pretty sure it's 4

Step-by-step explanation:

you take the point (1,4) and make it so y is over x (y/x), which gets 4/1, so the constant of proportionality would be 4

Jeane earned $62.95 every week for babysitting. How much did she earn in 6 weeks?

Answers

Answer:

377.7

Step-by-step explanation:

because you multiply 62.95 times 6

hopes this helps

Answer:

$62.95*6= $377.7

because it say how much did she earn in six weeks. So your going to multiply $62.95 and 6  and you should get $377.7.

Brainliest please have a good day, yo girl trin

Answer plz ASAP, I will give brainliest no links

Answers

Answer:

A: (10k+m)(10k−m)

Step-by-step explanation:

What is the area of the polygon below?

Answers

Answer:

65 units²

Step-by-step explanation:

The polygon is the combination of two rectangles.

Sides of the greater rectangle:

3 - (-8) = 11 and-2 - (-7) = 5

Sides of the smaller rectangle:

0 - (-5) = 5 and-7 - (-9) = 2

Area of the polygon:

11*5 + 5*2 = 65 units²

Which set of ordered pairs represents y as a function of x?
O {(1,5), (2,5), (3,4), (1,4)}
O {(7,8), 6,2), (3,2), (6,7)}
{(0,9), (2,8), (3,5), (1,8)}
o {(7,3), (2,6), (1,4), (2,8)}

Answers

Answer:

(2,8), (3,5),

Step-by-step explanation:

Neil has 3 partially full cans of white paint. They contian 1/3 gallon, 1/5 gallon and 1/2 gallon of paint. About how much paint does neil have

Answers

Answer:

1 1/30 gallon

Step-by-step explanation:

Can A = 1/3 gallon

Can B = 1/5 gallon

Can C = 1/2 gallon

Total paint Neil has = Can A + Can B + Can C

= 1/3 + 1/5 + 1/2

The lowest common multiple of 3, 5 and 2 is 30

= (10+6+15) / 30

= 31/30

= 1 1/30 gallon of paint

Neil has a total of 1 1/30 gallon of paint

Choose the correct symbol

Answers

Answer:

[tex]2,000lb < 1 t[/tex]

Step-by-step explanation:

1 Ton = 2,240 lb

Other Questions
PLEASE HELP AND NO FILES PLEASE1. you spin a penny and a nickel on a table. The penny lands on heads and the nickel lands on tails. find the probability2. A container has 7 green buttons, 3 yellow buttons, and 4 blue buttons. You reach in and randomly draw out a blue button. You KEEP the blue button and reach in again to draw out a second blue button. find the probability. You decide to study the effects of smoking, drinking and partying on life satisfaction. To do so, you assign people randomly to one of two smoking conditions (smoking or not), one of three drinking conditions (no alcohol, 1 drink per day, several drinks per day) and partying conditions (no partying, 1 hour of partying per day, 2 hours of partying per day). This design has An obstacle to sustainable development is the growth of ecotourism increasing reliance on fossil fuels negative population growth in developed countries farm to table restaurants decrease mass consumption If angle 3 is 4x+1 and angle 4 is 7X+3. what are the measures of angle 3 and 4? Which of the following is NOT a benefit of fitness walking?O Improves your visionO Strengthens your hearto Improves self-image and releases stressO Can be done anywhere, in any weather When identifying properties of n - sided polygons where 3 _< n Choose the correct simplification of the expression a^9 multiplied by b^10/a^2 multiplied by b^7A^11b^171/a^11b^171/a^7b^3A^7b^3 Suppose you invest money in two accounts. One of the accounts pays 4% interest annually, andthe other account pays 5% interest annually. You have $ 2000 more invested in the account paying4% than in the account paying 5%. How much do you have invested in the account paying 4% ifyou earn $ 670 interest in a year? Fill two Zip Loc bags half full of water. Put food coloring in both bags. Zip both bags. Tape one bag to a sunny window. Tape the other bag to a shady window. After 30 minutes, observe the bags to see which one changed the most. The purpose of the directions above is to OA. describe the results of a safe science experiment OB. entertain the reader with a game of plastic bags. OC. describe the process for a science experiment. OD. persuade the reader to use a certain kind of bag. What belief system was endorsed by the state that ruled the holy land in 550 CE 3. What organ(s) did Jason donate to Ronald Griffin? sub (7x+5)(2x28x+6). The boxing world has many famous fights. I will give 3 options of fights that I would like you to research and give me the history of the fight. When it took place, where, who was involved and why it was so significant. In your own words write a paragraph on the fight you choose. Options1) Thrilla in Manila2) Mike Tyson vs. Evander Holyfield3) Rumble in the Jungle A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include Which of the following could be the number shown on the number line? 6Which of these statements is true?Acceleration in the direction of motion slows you downB.Acceleration in the direction of motion speeds you upCAcceleration against the direction of motion has no effecton your speedDAcceleration against the direction of motion speeds you up Interest groups and political action committees are both types of organizations thatwrite and pass laws at the state and local levels.are not part of the government, but can influence thegovernment.hold debates and town hall meetings to inform voterson major election-season issues.raise unlimited money for political campaigns and candidates. "Master", I said "this sayings had for me."This sentence primarily reflects the role ofA. Dante as PilgrimB. Dante as PoetC. Virgil as guideD. Virgil as teacher Suri makes $15 per hour and gets a weekly bonus of $25. Juan makes $14 per hour and gets a weekly bonus of $50. Is it possible for Suri and Juan to makethe same amount of wages, y, by working the same number of hours, x, in one week?O Yes, because the slopes of the equations are different so the system of equations will have one solution.No, because the slopes of the equations are different so the system of equations will have no solutions.O Yes, because the slopes of the equations are the same so the system of equations will have infinitely many solutions.No, because the slopes of the equations are the same so the system of equations will have no solutions. The area of a rectangle is 20 mm2. If the width is 4 mm, find the length?