Read the lines from "She Walks in Beauty."
She walks in beauty, like the night
Of cloudless climes and starry skies

Read The Lines From "She Walks In Beauty."She Walks In Beauty, Like The NightOf Cloudless Climes And

Answers

Answer 1

Answer:

A simile

Explanation:

Similes are like "He ran like a Lion" or "She talked as graceful as a dove." They often are comparing one thing to another.

Answer 2

Answer:

A simile

Explanation:

edge 2020


Related Questions

Pedro gathers his younger brothers and told them it is time to go home.


How can you edit this sentence so that there is no shift in verb tense?

Change "it is" to "it was"

Change "gathers" to gathered"

Change "told" to "tells"

All of the above

Answers

Answer:

Change "told" to "tells"?

Change "told" to, "tells" can you edit this sentence so that there is no shift in verb tense.

What is a sentence?

A sentence is a verbal expression in linguistics and grammar, as in the English example "The swift brown fox jumps over the slow dog." It is often described in conventional grammar as a group of words that conveys a full notion or as a unit made up of a subject and predicate.

A sentence fragment is a set of words that appears to be a complete sentence but isn't. Typically, sentence fragments lack a subject or verb or do not fully articulate a notion. A clear illustration of a sentence fragment is given below owing to the rain.

You have generated an incorrect shift when you begin a sentence in one tense (past, present, or future) but then flip to another tense. Although she is a gifted athlete, she lacked good manners. This phrase starts out in the present tense before switching to the past tense.

Therefore, Thus option (C) is correct.

Learn more about sentence here:

https://brainly.com/question/18728726

#SPJ2

What is the purpose of a caption?

Answers

Answer:

To let you know what the speaker is saying, because sometimes they might talk to fast and I won't hear all of it. Caption presents the speech of the speaker for u to read and follow along as they talk.

Answer:

a caption is too draw attention to something in the image that is not obvious such as it relevance to the text

PLS HELP!!!! What part of speech correlates with the following capitalized word(s) in the
sentence (there is only 1 correct part of speech): He WILL BE GOING to the
party. *
1.Interjection
2.Pronoun
3.Conjunction
4.Noun
5.Adverb
6.Adjective
7.Preposition
8.Verb

Answers

Answer:

should be a verb

Explanation:

none of the other ways make sense but it does have tricky wording, I don't know i don't really like the question.

1: What can the reader infer from textual evidence in the last paragraph?
A: All pets with allergies will exhibit irregular behavior.
OB: A check-up will ensure that your pet will remain allergy free.
C: Allergies can affect cats and dogs at any time, and at any age.
D: Humans are more likely to be affected by allergies than animals.

Answers

Answer:

OB: A check-up will ensure that your pet will remain allergy free.

Explanation:

This is true going by the suspicion by the person about the reaction of the pet being due to allergies. In order to resolve this issue, there is need to do a thorough medical check-up on the pet. This would help in the treatment of the allergies leading to it being allergy-free.

Refer to “The most important day” by Helen Keller
Which phrase best shows Helen Keller’s motivation for wanting to learn more?
Answer:

“It was the third of March, 1887, three months before I was seven years old.”

“ Neither sorrow nor regret followed my passionate outburst.”

“Anger and bitterness had preyed upon me continually for weeks ...”

“ Running downstairs to my mother, I held at my hand and read the letters for my doll.”

“ That living word awakened my soul, gave it light, hope, joy, set it free!”

Answers

Answer:

it's A

Explanation:

i did this for a project but if I'm wrong then it can also be D

The term Pax Mongolica describes
A.
the treaty agreements the Mongols required of all the peoples that they conquered.
B.
the rights and responsibilities of the peoples conquered by the Mongols.
C.
the guarantee given by the Mongols not to invade India or the Arabian Peninsula.
D.
the period of peace and stability in Asia following the conquest of the Mongols.

Answers

Answer:

the period of peace

Explanation:

pax means peace un Latin

Answer:

The period of peace and stability in Asia following the conquest of the Mongols.

Explanation:

The Pax Mongolica, also known as the Mongol Peace, refers to the period of relative peace and stability in Asia following the conquest of the Mongols. The Mongols created an empire that stretched from the Pacific Ocean to Europe. Once an area was conquered, the Mongols required that the people pay tribute to their new rulers, but local customs were allowed to continue.

Which of the following sentences uses a first-person point of view? Lois, angrier than she had ever been, stood abruptly and stormed out of the office. He was a small man, gray and sickly in complexion, but with eyes as alive as the sun. I woke up with a jump, startled by the clanging cry of my alarm. Jim, always the practical joker, moved towards her quietly.

Answers

Answer:

I woke up with a jump, startled by the clanging cry of my alarm.

Explanation:

First-person point of view uses words like "I", and "My".

Answer:

the answer is c

Which important step comes between the first and final drafts of a piece of
writing?
A. Revision
B. Initial writing
C. Brainstorming
D. List-making

Answers

Answer:

A

Explanation:

revision

Give Us Our Peace

Give us a peace equal to the war
Or else our souls will be unsatisfied,
And we will wonder what we have fought for
And why the many died.

Give us a peace accepting every challenge—
The challenge of the poor, the black, of all denied,
The challenge of the vast colonial world
That long has had so little justice by its side.

Give us a peace that dares us to be wise.
Give us a peace that dares us to be strong.
Give us a peace that dares us still uphold
Throughout the peace our battle against wrong.

Give us a peace that is not cheaply used,
A peace that is no clever scheme,
A people’s peace for which men can enthuse,
A peace that brings reality to our dream.

Give us a peace that will produce great schools—
As the war produced great armament,
A peace that will wipe out our slums—
As war wiped out our foes on evil bent.

Give us a peace that will enlist
A mighty army serving human kind,
Not just an army geared to kill,
But trained to help the living mind—
An army trained to shape our common good
And bring about a world of brotherhood.

—Langston Hughes
from The Chicago Defender, August 25, 1945

1. The prevailing tone of the poem is
(1) demanding (3) celebratory
(2) angry (4) proud

2. What is most likely not a purpose of the repetition
of the phrase “Give us a peace” throughout the
poem?
(1) to provide a unified structure
(2) to emphasize a central idea
(3) to solicit the people’s loyalty
(4) to introduce the poet’s requests

3. The military references throughout the poem
serve to
(1) recall the heroic cause of war
(2) stress the destructive nature of war
(3) rally the people for a new form of war
(4) warn the people of an impending war

4. The poet’s purpose in the poem can best be
described as
(1) a condemnation of war
(2) an appeal for justice
(3) an argument for colonial values
(4) a criticism of education

Answers

Answer:

I'm not 100% sure if these answers are correct...

Explanation:

#1. I think it's either 1 or 4

#2. 2

#3. 4 I think...

#4. 2 I think

1. The prevailing tone of the poem is option 2: Angry

2. Most likely not a purpose of the repetition of the phrase "Give us a peace" throughout the poem is option 3: to Solicit the people's loyalty

3. The military references throughout the poem serve to is option 2: Stress the destructive nature of war

4. The poet's purpose in the poem can best be described as is option 2: An appeal for justice

The prevailing tone refers to the overall mood or attitude conveyed in a piece of writing. It reflects the dominant emotional quality or atmosphere that the author creates through their choice of words, imagery, and the overall expression of their ideas.

Learn more about repetition here:

brainly.com/question/30154223

#SPJ2

PLZ HELP!!!What part of speech correlates with the following capitalized word(s) in the
sentence (there is only 1 correct part of speech): THE BEAUTIFUL ring was
A gift. *
1.Verb
2.Conjunction
3.Pronoun
4.Noun
5.Adverb
6.Interjection
7.Preposition
8.Adjective

Answers

The answer is 8. Adjective because it describes a noun
The answer is 8 adjective

Reread paragraphs 13-15 of “Priscilla and the Wimps” and paragraphs 12-15 of “All Summer in a Day.” Then answer the multiple-choice questions that follow.


From “Priscilla and the Wimps” by Richard Peck

13 “Okay, let’s see your pass,” snarls the Kobra.


14 “A pass for what this time?” Melvin asks, probably still dazed.


15“Let’s call it a pass for very short people,” says the Kobra, “a dwarf tax.” He wheezes a little Kobra chuckle at his own wittiness. And already he’s reaching for Melvin’s wallet with the hand that isn’t circling Melvin’s windpipe. All this time, of course, Melvin and the Kobra are standing in Priscilla’s big shadow.

From “All Summer in a Day” by Ray Bradbury

12 Margot stood apart from them, from these children who could not ever remember a time when there wasn’t rain and rain and rain. They were all nine years old, and if there had been a day, seven years ago, when the sun came out for an hour and showed its face to the stunned world, they could not recall. Sometimes, at night, she heard them stir, in remembrance, and she knew they were dreaming and remembering gold or a yellow crayon or a coin large enough to buy the world with. She knew they thought they remembered a warmness, like a blushing in the face, in the body, in the arms and legs and trembling hands. But then they always awoke to the tatting drum, the endless shaking down of clear bead necklaces upon the roof, the walk, the gardens, the forests, and their dreams were gone.


13 All day yesterday they had read in class about the sun. About how like a lemon it was, and how hot. And they had written small stories or essays or poems about it: I think the sun is a flower, That blooms for just one hour. That was Margot’s poem, read in a quiet voice in the still classroom while the rain was falling outside.


14 "Aw, you didn’t write that!" protested one of the boys.


15 "I did," said Margot. "I did."


------------------------------------------------------------------------------------------------------------


From the excerpts above, the reader can infer that another theme across both texts is —


Answer choices for the above question


A. Violence is not a successful way to solve problems.


B. People are often unkind toward those who are different from them.


C. Sometimes people hide their fear by being mean to others.


D. It’s better to avoid or hide from a bully than try to confront one.


------------------------------------------------------------------------------------


The sentences from each text that best suggest this theme are —


Answer choices for the above question


A. From “Priscilla and the Wimps”: “Okay, let’s see your pass,” snarls the Kobra. From “All Summer in a Day”: "Aw, you didn’t write that!" protested one of the boys.


B. From “Priscilla and the Wimps”: He wheezes a little Kobra chuckle at his own wittiness. From “All Summer in a Day”: That was Margot’s poem, read in a quiet voice in the still classroom while the rain was falling outside.


C. From “Priscilla and the Wimps”: “Let’s call it a pass for very short people,” says the Kobra, “a dwarf tax.” From “All Summer in a Day”: Margot stood apart from them, from these children who could not ever remember a time when there wasn’t rain and rain and rain.


D. From “Priscilla and the Wimps”: And already he’s reaching for Melvin’s wallet with the hand that isn’t circling Melvin’s windpipe. From “All Summer in a Day”: But then they always awoke to the tatting drum, the endless shaking down of clear bead necklaces upon the roof, the walk, the gardens, the forests, and their

Answers

Answer: the first one will be C the one down D

Explanation: i just take the test about 10 days ago

Answer:

1.B

2.D

Explanation:

i am doing the test rn

HOPE THIS HELPED!!!!

What are the Four Goods of the human nature that we all should consider and follow its desires?​

Answers

Answer:

The Four Goods of the human nature that we all should consider and follow its desires is explained below in detail.

Explanation:

The correct answer is to follow THE EIGHT FOLD PATH. There are four excellent truths in Buddhism about human nature:

1. everything in life is misery and sadness

2. the source of all suffering is people self-centered desires

3. the mean of controlling suffering is to end all desire

4. the way to succeed in all suffering is to follow the eightfold path.

Write a paragraph why plastic should be reduced include two supporting reasons why. Your answer should be 4-6 sentences. PLEASE HELP!!

Answers

I’ll give you topics, and all you have to do is elaborate on what i’m saying.

-Plastic is currently and has been destroying the livings health: Sea-Animals are getting caught in soda wraps.

-Plastic is polluting the earth, and is harming US

-It’s so easy to just reuse, and recycle. Throw it in the bin!

- Think of all the animals that are dying because of us humans littering, and not doing the right thing.

Can someone help me quick pelase!

Collecting research data is the final step in the scientific method,
Please select the best answer from the choices provided

-True

-False

Answers

Answer:

I think the answer is false

The answer is false

Explain what historical fiction is, using your own words.

Answers

Answer:

Historical fiction is a literary genre where the story takes place in the past. Historical novels capture the details of the time period as accurately as possible for authenticity, including social norms, manners, customs, and traditions. Many novels in this genre tell fictional stories that involve actual historical figures or historical events.

Explanation:

Answer:

Historical fiction is the usage of real life events that have occurred, brought to the reader through the fictional lens of people who (to the audience/author's knowledge) never existed. To put it simply, historical fiction uses things that could've happened, and people that could've been, (yet as far as we know are fictional) to explore ideas, feelings, or ways of life around specific time periods in history.

2. Is it OK to bend the rules to get something or to do something in your life? why?​

Answers

The answer is correct

I NEED HELP ASAP PLEASE
Read the poem.


Ozymandias


by Percy Bysshe Shelley


I met a traveller from an antique land,

Who said—“Two vast and trunkless legs of stone

Stand in the desert. . . . Near them, on the sand,

Half sunk a shattered visage lies, whose frown,

And wrinkled lip, and sneer of cold command,

Tell that its sculptor well those passions read

Which yet survive, stamped on these lifeless things,

The hand that mocked them, and the heart that fed;

And on the pedestal, these words appear:

My name is Ozymandias, King of Kings;

Look on my Works, ye Mighty, and despair!

Nothing beside remains. Round the decay

Of that colossal Wreck, boundless and bare

The lone and level sands stretch far away.”


What is the structure of "Ozymandias"?



limerick


sonnet


free verse


haiku

Answers

Answer: sonnet

Explanation:

“Ozymandias” is a sonnet, in this case a variant of a Petrarchan sonnet. The Petrarchan sonnet is divided into an 8-lined octave that creates a situation and a 6 line sestet that comments on the situation.

Which version best uses a variety of sentence structures to enhance the flow
and writing style of a story?
A. Dante picked up his trading cards. He slid each one into the
binder, Mariah had finally traded him a Silver Knight. He smiled to
himself. She had asked for six cards in return. It was worth it.
O B. Smiling to himself, Dante picked up his trading cards, and he slid
each one into the binder. When Mariah had finally traded him a
Silver Knight, she had asked for six cards in return, but it was
worth it.
O C. Smiling to himself, Dante picked up his trading cards. He slid each
one into the binder. Mariah had finally traded him a Silver Knight.
She had asked for six cards in return, but it was worth it.
D. Dante picked up his trading cards, and he slid each one into the
binder. Mariah had finally traded him a Silver Knight, so he smiled
to himself. She had asked for six cards in return, but it was worth
it.

Answers

Answer:

C??

Explanation:

I'm not sure if this is right or wrong..

Sorry if it wrong

Why does Jing-Mei feel like she doesn’t know her mother?

Answers

Jing-Mei's mother feels that she is doing everything she can to provide opportunities for her daughter. When Jing-Mei through a temper tantrum about the piano lessons it upset her mother. Her mother felt that her daughter did not appreciate what she was trying to do for her.

Answer:

Jing-Mei's mother feels she is doing everything possible to provide opportunities for her daughter. When Jing-Mei through a temper tantrum about the piano lessons, it upset her mother. Her mother felt that her daughter did not appreciate what she was trying to do for her.

Explanation:

Most space debris is created when satellites ________. *

A. fall back to Earth
B. stop working
C. collide or explode

Answers

Answer: Most space debris is created when satellites collide or explode.

Which sentences describe how Sara revised and edited her research report about the ERA? (Select all correct answers.)
She added more and stronger transitions between sentences.
She added evidence that she had initially left out.
She re-organized all of her paragraphs.
She replaced informal language with academic discourse.

What do the topic sentences in a report show you?
the style and tone of the report
the purpose of the report
the report’s intended audience
the overall structure of the report

Which phrases do describe features of academic discourse? (Select all correct answers.)
short, simple sentences
longer, more complex sentences
a formal tone
advanced vocabulary

Answers

Answer:

creo es 82 y una longitudinal 626

Is it correct to say this or is there a better way of saying, " I don’t think she is a native of this country. She doesn’t look or sound like someone from this geographical boundary "

Answers

Answer:

Yes

Explanation:

Which statement reveals a change in Creon's character?
you won't change my mind to make yourself more rich.
The tribe of prophets-all of them-are fond of money.
You're a wise prophet,/but you love doing wrong.
Until one dies the best thing well may be to follow our established laws.

Answers

Answer:

D. Until one dies the best thing well may be to follow our established laws.

Explanation:

Which sentence describes the plot of a myth?

The daughter of a goddess is kidnapped and made to live underground for half of the year.

A man realizes that he is a "superhero" to his young son and daughter.

A dog and cat wander along a road, hoping someone will rescue them together.

A monkey tricks a crocodile into carrying him across the river to a banana tree.

Answers

The last sentence hope this helped!!

A monkey tricks a crocodile into carrying him across the river to a banana tree is a sentence that describes the plot of a myth. Thus option (d) is correct.

What is a sentence?

A sentence is a set of words that are put together and which has meaning or makes complete sense of something. A sentence is the basic unit of language which expresses or makes a complete thought.

A sentence is formed by following the grammatical basic rules of syntax. For example:" John is running". A complete sentence has at least a subject and a main verb to state (declare) a complete thought. For example: Kate walks.

The first letter of the first word in a sentence will always be capital. At the end of the sentence there is a punctuation mark depending on whether it is a statement, a question, a command, a request or an exclamation.

Learn more about sentence here:

https://brainly.com/question/29140135

#SPJ5

Which statement is true about dialogue in short stories?

Answers

Answer:

wheres the questions?

Explanation:

Answe YW

Explanation:

Dialogue using the character’s own words is one way a writer can show rather than tell readers what a character is like.

Please help me ASAP I’ll mark Brainly

Answers

he’s allergic to cats

what is the climax to the wishbone valley

Answers

Answer:

The rising action in the story was when the gobbler appeared to Donald and accused him of eating it and breaking his wishbone with his sister. The rising action continues as he leads him towards the wishbone valley to meet the ghosts of the other turkeys.

Explanation:

The rising action in a story refers to the events that build up suspense in the mind of the reader. It builds towards the climax of the story where the main suspense is created and later resolved. When the gobbler appears to Donald and has that conversation where he accused Donald of eating it, the writer was building suspense.

The suspense continues when he leads him on to the Wishbone Valley, and Donald showed some hesitation because of fear.

Abomination in a SIMPLE SENTENCE
(Please help)

Answers

Answer:

the cruel treatment of prisons was abominable

means the same thing

Answer:

Anyone who commits an extreme and serious crime such as being a murderer is an abomination to society.

Though she tried to like Halloween, Heather saw it as an abomination and despised all October 31st festivities.

You're an abomination if you like more salt than sugar in cookies.

Which passage below best
reveals the cultural setting of
"A Piece of String"?
A. And he grew angry, becoming
exasperated, hot and distressed at not
being believed
B. He felt it, consumed his heart over it
and wore himself out with useless efforts.
He wasted away.
C. their wives, walking behind the animal,
whipped its haunches with a leafy branch

Answers

Ummmmm I would need to see the passage in order to answer this :)

Read the passage.


Earthships


­­­­­What is an earthship?


An earthshi­­­p is a home designed to make use of recycled materials and increase energy conservation. Ideally, by living in an earthship, a person can have a home that is “off the grid.” People who live in earthships do not depend on outside sources for electricity, food, or water. Building an earthship may be an attractive choice for those who want to use fewer of our planet’s non-renewable resources.


The Foundation


First, the foundation is built by firmly packing dirt inside recycled tires. Then, the tires are placed in a pyramid-like stack going as high as needed. Next, cement is spread and smoothed between the tires to create a solid wall. When this is finished, the walls are sealed with a protective coating and painted. Some interior walls are built using recycled cans and cement, also sealed with a protective coating.


Solar Energy


Solar panels give enough stored energy in batteries to provide electricity for appliances, lighting, and electronics. However, solar-powered batteries hold about one-third the charge of energy used in a regular household wired for electricity. This means that people either buy more batteries or intend to use less electricity than a conventional household. Ideally, earthships are built in places where there is an abundance of sunshine year-round.


Floor-to-ceiling windows on an earthship’s south wall also allow plenty of sunlight. It is important that no trees block the light on this side of the house. The sunlight shines directly onto a brick floor, which then absorbs the heat. This provides enough warmth to maintain a comfortable temperature in the house for the rest of the day. This method of heating the home is called passive solar. Most earthships also have either a wood stove or a heater that uses propane, a type of natural gas. These heat sources are useful on cloudy days. During the summer, the combination of the cool temperature of the earth beneath the floor plus the thick walls can keep the house comfortable without the use of air-conditioning.


Recycled Water


Gutters on the roof collect rainwater that then trickles down into large storage barrels. The water is used for taking showers, doing dishes, and flushing the toilet. It is also filtered for drinking. People sometimes build a greenhouse to grow their own food. Water that has been used for dishwashing or showers can be saved if the soaps are chemical-free. This recycled “gray” water can be used yet again to water the plants in the greenhouse.


Potential Problems


Earthships have been around since the 1970s. Now, ­­long-term studies have revealed some problems. For one, without sufficient sunlight during the winter, large amounts of natural gas known as propane and/or wood are used to heat the home. Propane use can be costly, and unless one has planned far ahead, a wood supply can be quickly depleted.


Another problem is that tires used in the foundation walls can, after a long period of time, begin to crack, releasing a toxic gas that has built up over time in the walls. The use of cement, which is a porous material with many small holes and spaces, allows the gases to leak into the air. The type of gas emitted is not detectable by smell but can make people sick. To address this problem, the walls of the home needs to be resealed every year.


Cost can also be a significant challenge. Some earthship building companies claim that it is far cheaper to build an earthship because only recycled materials are used. Also, a contractor’s license or training is not needed to build one. This, though, is true if it is built 100% by the owner, which could take years to complete. Additionally, the cement, plumbing, and electrical components, as well as the cost of installing solar panels, can be expensive. Just as with the construction of a conventional home, proper permits are often needed to build an earthship.


There are clear advantages and disadvantages to these unique homes. As technology improves and new solutions are discovered, earthships may continue to be a wise way to live sustainably using minimal resources.


What inference can be made about how building earthships impacts the environment?


Question 5 options:


It is beneficial because it removes unnecessary trees.



It is harmful because it uses old tires.



It is wasteful because solar panels are expensive.



It helps by using mostly recycled material instead of natural resources.

Answers

Answer:

It helps by using mostly recycled material instead of natural resources.

Explanation:

According to the passage, an earth ship is a home that is designed to make use of recycled materials in an effort to save the planet and conserve energy. This is important and essential for people that want to go off the grid and use less of the non-renewable earth resources.

The inference that can be made about how building earthships impacts the environment is that it helps by using mostly recycled material instead of natural resources.

Other Questions
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Bryan wants to buy a new pair of jeans. If the jeans were originally $45.00, but are on sale with a 20% discount, how much will Bryan have to pay for the jeans? MR. ARCEO TAKES A TAXI FROM THE AIRPORT TO A HOTEL. THE TAXI CHARGES $2.50 INITIAL CHARGE PLUS $2.65 PER MILE. WHICH EQUATION CAN BE USED TO FIND Y, THE TOTAL COST OF THE TRIP, IF X REPRESENTS THE NUMBER OF MILES OF THE TRIP? Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia What is greater -3.2 or -3 2 MATH K.Parker is trying to solve the addition problem below.58 +36 =Drag and drop the numbers below to complete each sentence.Is and PlaceParker will need to change!ones intoten andones. The answer to the addition probleman and1000is 58 +36 =945 - Part 12.: 3:: 5:: 13:: 14:: 15! 84s - Part 2Next2 of 13Copyright 2020 Edmentum, Inc. All Rights ReservedPrivacy Policy California Privacy Rights Contact10:3 List two equivalent numbers to 0.50 Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make? You know I never approved of it, pursued Utterson, ruthlessly disregarding the fresh topic.My will? Yes, certainly, I know that, said the doctor, a trifle sharply. You have told me so.Well, I tell you so again, continued the lawyer. I have been learning something of young Hyde.The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. I do not care to hear more, said he. This is a matter I thought we had agreed to drop.The Strange Case of Dr. Jekyll and Mr. Hyde,Robert Louis StevensonWhere in the plot is this passage found?the expositionthe rising actionthe falling actionthe resolution 1. (04.04 HC)Lee y escoge la mejor respuesta. Read and select the best answer.Hoy en da, hay muchos estudiantes que estn perdiendo algo muy importante y profundo en su educacin. Esta es la presencia de la msica y el arte en las escuelas. El estudio del arteayuda a enriquecer a los estudiantes y exponerlos a otras culturas y perspectivas. Estas experiencias ayudan a prepararlos para el futuro. Deberamos gastar ms dinero en el arte y no soloen las ciencias y las matemticas.(1 point)Segn la lectura, que podra ser un gancho para esta lectura? Un gancho para esta lectura podria serO el arte no debera estar en la escuelaO qu es el arte para ti?O cul es el valor de una educacin artstica?O solamente las ciencias y las matemticas How do blood types react in a transfusin ? Tarshiss article is mainly about A. the U.S. Navys secret missions B. the construction of the Titanic C. creatures that thrive in the deep seaD. one mans quest to find the Titanic pls explain how to do this Which of the following is an example of a topic that is too narrow or not going have enough information?Explaining the process of solar power.The effects of drought on farmers in California.The process of inflating a flat bicycle tire.Comparing the North and South poles. plz help me with this James is playing a dice game. He is rolling two 6-sided dice. To win, the two dice must sum to anumber greater than 7. What is the probability that he will win? Cathy's favorite salad dressing is a liquid with particles of salt, pepper, and garlic. When comparing a spoonful of salad dressing to a cell, what would the liquid be equivalent to? What would the particles be equivalent to? PLS ANSWER QUICKLY AND ILL MARK U BRAINLIESTWhat is one similarity between a sitcom and one-act playspecific types of jokesthey both have one acta main messageone main character