Researchers do an experiment to test the hypothesis that Douglas fir trees put more resources into reproduction when they are infected with a fungus that causes a fatal disease. They establish study plots in a group of 50-year-old Douglas fir where the disease is not present. At random, they infect half the trees with the disease-causing fungus. Then they measure how many cones and seeds are produced by infected versus uninfected trees

Answers

Answer 1
More infected than uninfected trees will die.

Related Questions

6. In an ecosystem, sometimes more than one animal is a predator to the same animal. For example, the great barn owl and the the bald eagle both share a habitat, and they both hunt mice. Which answer explains how this relationship can work? a. They are both hunted by the red fox. b. The eagle migrates to other ecosystems. c. The owl hunts at night, and the eagle hunts during the day. d. There is an overpopulation of owls.​

Answers

Answer:

C. The owl hunts at night, and the eagle hunts during the day.

Explanation:

They both have an equal opportunity to get food just at different times.

Describe the distribution of Earth’s water resources.

Answers

Answer:

Look at the Eplanation Below.. >>>

Explanation:

The distribution of water is not uniform in both the hemispheres of earth. It is estimated the 43 % of total area covered by water lies in northern hemisphere where as the remaining 57 % lies in the southern hemisphere. About 96.5 % of total water are in the form of ocean . Rest water are present in the form of river ,lake , pond , water vapour etc.

please answer this for me

Answers

Answer:

more flexibility in movement

Explanation:

it allows the worm to pass waves of movement along its body to move through loose earth.

According to the theory of natural selection, what is an ability of individuals that makes them more likely than others to survive and reproduce?
A The ability to change their environment
В.
The ability to avoid mutations in their genes
C.The ability to have multiple offspring
D
The ability to adapt to their environment

Answers

Answer:

D

Explanation:

It could be A but we easily adapt to our environment that animals. B is definitely out of it and C is a characteristic of animals as well

which process reduces the number of chromosomes by half

Answers

Answer:

Meiosis process reduces the number of chromosomes by half.

Explanation:

Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells.

Answer:

meiosis

Explanation:

meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells

What is the female reproductive structure of a flower called?
A. Pistil

B. Stamen

Answers

A. Pistil

This is the answer.

Answer:

The female reproduction structure of a flower called pistil.Explanation:A.pistil

hope it helps ✌✌

What might analysts be able to use tunable lights for?

This is for a forensics class.

Answers

Explanation:

crime scene investigators and forensic examiners are now using "alternate light sources" to identify residues and prints which cannot be seen under normal light conditions.........could there be a role for them to this end?

Which of the following organelles is properly matched to it's function?


lysosome: storage

endoplasmic reticulum: movement

lysosome: digestion

chloroplast: making proteins

Answers

The organelle properly matched to it's function is

-(C) lysosome: digestion

Explanation:

Lysosomes : It hold enzymes that were created by the cell. The purpose of the lysosome is to digest things. They might be used to digest food or break down the cell when it dies

Endoplasmic reticulum : to produce proteins for the rest of the cell to function.

Chloroplast : They are responsible to carry out photosynthesis

Complete the T-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. Some answers will fit in both columns depending on the situation.

Predator-prey relationships
Competition
Toxins
New habitat
Disasters
Increased food source
A 2-column table has columns with labels Increase variation and decrease variation.

Answers

Answer: 1. Decrease 2. Decrease 3. Both 4. Both 5. Decrease 6. Increase

Explanation: I got it right hopefully it helps

Answer:just did it

Explanation:

what is a good definition of photosynthesis?
A. using glucose to create light

B. putting together lights so we can see

C. using light to put together food (glucose)

Answers

Answer:

The best answer is C

Explanation:

Plants use light  to create their own food. this is called  photosynthesis

Answer:

C

Explanation:

The process of photosynthesis uses light to create food and uses other gas like carbon dioxide.

Which common resource is being degraded in the photograph?
A. Pastureland
B. Atmosphere
C. Ocean
D. Freshwater

Answers

Answer:

b

Explanation:

The direction of force of Earth's magnetic field is from the geographic South
Pole to the geographic North Pole. Where is Earth's magnetic north pole?
O A. Near Earth's center
O B. Near Earth's equator
O C. Near Earth's North Pole
O D. Near Earth's South Pole

Answers

I am pretty sure it’s D) Near Earth’s South Pole, I’m so sorry it’s it’s wrong

Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3

Answers

Answer and Explanation:

La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.

Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.

El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.

ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3

Codones   ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT

ARNm ⇒  UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA

Codones  UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.

Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.

AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU

La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.

UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

TYR  SER  TRP  VAL   Stop  THR  ARG  ILE  ARG  PHE  PHE  Stop

which structure is unique to eukaryotic cells

Answers

Answer:

Unlike prokaryotic cells, eukaryotic cells have a membrane-bound nucleus, a central cavity surrounded by a membrane that houses the cell's genetic material. A number of membrane-bound organelles, compartments with specialized functions that float in the cytosol.

Explanation:

hope this helps

What three things are needed for photosynthensis? (select all that apply)
Oxygen

Carbon Dioxide

Water

Sunlight

Answers

Definition of Photosynthesis

Photosynthesis is the process in which green plants produces their own food.

things that photosynthesis needs to occur are;

WaterSunlightWarmth

Answer:

Carbon DioxideWaterSunlight

Explanation:

Plants need three things to perform photosynthesis, they are carbon dioxide, water, and sunlight.

What is the smallest LIVING part of an organism?

A. Molecules

B. Cells

Answers

Answer:

Hi, there the answer is a cell

Explanation:

The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.

Answer:

B. Cells

Explanation:

The cells are the smallest living part of an organism.

please help me answer this

Answers

Answer:

last one a dormancy structure D

Explanation:

It helps keeps bacteria and stuff dormant`

IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE

Answers

Yup it is correct

Hope u get good marks stay safe
:D

Photosynthesis in plants is an example of​

Answers

Answer: If you are asking if your answer is correct, it is. Photosynthesis is the process of converting sunlight into food and energy, therefore it is an example of nutrition.

Photosynthesis in plants is an example of nutrition

What is photosynthesis?

Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of sugar.

It is carried out by algae, plants and even some microorganisms.

The sugar produced form photosynthesis is a great source of nutrients for photosynthetic organisms and plants.

Therefore, photosynthesis in plants is an example of nutrition

Learn more about photosynthesis here:

https://brainly.com/question/3529377

#SPJ9

what are alleles mutations in the dna

Answers

Answer:

Mutations Are Recessive or Dominant

2. Ang
ay isang genre na gumagamit ng mahika at
iba pang supernatural na penomena bilang punong elemento
ng plota, tema, at/o ganapan.
A. Pabula B. Drama
C. Pantasya D. Mga Tula​

Answers

Answer:

C. Pantasya

Explanation:

Ang anumang genre ng pantasya ay magkakaroon ng isang uri ng supernatural o magic na tema na isinama dito

Sana nakatulong ito :)

which sequence demonstrates the increasing complexity of levels of organization in multuticelluar organisms ?

A organelle_cell_tissue_organ_organ system_oraganism

B cell_organelle_tissue_organ_organsystem organisms

C organelle_tissue_cell_organ_organ system organisms

D cell_organism _organ_organ system _tissue_organelle

Answers

Answer:

it's A

Explanation:

It's just a simple chain. Many Organelles form cell, many cells form a tissue, many tissues together form an organ, various organs together form an organ system and different organ systems together make a complete organism.

I hope it helps :))

Classify each of the samples in the grid below as one of the following substances. Each one may be used more than once:

Answers

si 0?no Nop suficientemente silvestre usuario independencia 6t?

what do you mean by faunal Diversity

Answers

Answer:

animal life especially

Explanation:

i hope it helps

this is my answer

correct me if im wrong

#carryonlearning

Blood is at it's highest pressure just when it leaves the heart. Why so?

Answers

Answer: Contractility of the left ventricle myocardium ensures that blood will have enough force to reach the rest of the body.

Explanation: Frank Starling Law....Cardiac output=heart rate x stroke volume.

Bacteria and fungi fulfill which role in an ecosystem?
A. Consumer

B. Decomposer

D. Producer

Answers

Answer:

B. Decomposer

Explanation:

Bacteria and fungi fulfill the role of decomposers in an ecosystem. Hence, option (B) is the correct answer.

Gizmos ( Building DNA )
Activity A :
Question : What is the structure of DNA
Build : follow the steps given in the gizmo to construct a molecule of dna

Answers

Answer:

Double Helical Spiral structure

Explanation:

DNA is a helical spiral structure in which two long strands of nucleotide form a double helix structure.

It looks like a structure of ladder in which the phosphate and sugar molecules from the side of the ladder and the base pairs form the rungs.

How are the early stages of embryonic development different from the later stages of development?

Answers

The early stages of embryonic development begin with fertilization. The process of fertilization is tightly controlled to ensure that only one sperm fuses with one egg. After fertilization, the zygote undergoes cleavage to form the blastula

A 43-year-old Caucasian man with a 20-year history of bipolar disorder presents for the first time with long-term polyuria and polydipsia. He previously took lithium for mood stabilization for 15 years before initiating divalproex sodium therapy. He stopped using lithium because of the polyuria, but he felt that the polyuria never fully subsided. His weight is stable, and he has no other urinary complaints. His blood pressure is 115/80 mmHg and his physical exam is normal. His urinalysis shows no blood, cells, protein, glucose, nitrate, casts, or crystals.
What is the most likely cause of his polyuria?
1 Central diabetes insipidus
2 Nephrogenic diabetes insipidus
3 Polyuria secondary to hyperglycemia
4 Polyuria following acute kidney injury
5 Polyuria secondary to polydipsia

Answers

Answer:

The correct option is 2 Nephrogenic diabetes insipidus.

Explanation:

Nephrogenic diabetes insipidus (NDI) occurs when the renal tubule response to vasopressin (ADH) is weakened, resulting in the excretion of large volumes of dilute urine.

As the renal tubules do not respond to vasopressin (antidiuretic hormone) and are unable to reabsorb filtered water back into the body, the kidneys create a high volume of dilute urine in nephrogenic diabetes insipidus.

Nephrogenic diabetes insipidus (NDI) can be inherited or develop as a result of disorders that impede the ability of the kidneys to concentrate.

Therefore, the correct option is 2 Nephrogenic diabetes insipidus.

That is, the most likely cause of his polyuria is nephrogenic diabetes insipidus.

sodium-potassium pump. Find out what this pump does for a cell, and explain it here.

Answers

Answer:

protein pump

Explanation:

This protein pump, also known as the Na+/K+ pump or Na+/K+-ATPase, is located in the cell membrane of neurons (and other animal cells). It works by transporting sodium and potassium ions across the cell membrane in a 3:1 ratio of sodium ions out to potassium ions in.

Answer:

Hello There!!

Explanation:

Here is the answer↬It transports sodium and potassium ions across the cell membrane.

hope this helps,have a great day!!

~Pinky~

Other Questions
To find 4 + 1, start at 0. Draw the arrow for 4. Then, from , draw the arrow for 1; the sum is . To find 4 + (1), start at 0. Draw the arrow for 4. Then, from , draw the arrow for 1; the sum is . Master Thomas's response to Douglass illustrates that slavery was in part based on differentiate the following by using "limit"[tex] \displaystyle \frac{d}{dx} \sqrt{x} [/tex] What is the equivalent resistance of a circuit that contains two 50.0 0resistors connected in series to a 12.0V battery? Which point lies on both y=5x3 and y=4x+6 ?(4, 14)(3, 1)(3, 10)(2, 6)(1, 2) Can someone pls help me with this?! Which of the following is equivalent to11/18?A. 0.61O B. 0.61C. 0.61D. 0.611 can u unscramble these letters to make a word still using every letter BALQUOFplz help (20 points)Question from Similarity Whichexpression is equivalent to -3-4 The probability the Sam sleeps for less than 6 hours is 0.25 work out the probability that Sam sleeps for 6 hours or more How is systemic racism present in our society? Wally bought a television for $987.00. The finance charge was $205 and she paid for it over 24 months. (Finance Ch arg e: #Months)(12) Amount Financed Use the formula Approximate APR to calculate her approximate APR. Round the answer to the nearest tenth. who is Danzethwhite? Someone pls help me ill give out brainliest pls dont answer if you dont know Do you think the three monotheistic religions (Judaism, Christianity, and Islam) are more similar than different OR more different than similar? A surfactant with a Hydrophile-Lipophile Balance (HLB) value of 18 is expected to function as a solubilizing agentO FalseO True it's not good___ apologizing to me now1)he is2)for him3) that him4)him Read this passage.Thomas Jefferson was a statesman, diplomat, one of the Founding Fathers, and the third president of the United States. Jefferson is also known for designing and building his home Monticello over a forty-year period.Which sentence could be added to the passage and maintain its formal style?Jefferson must have been a really smart guy to be able to do all that during his life.Monticello must be pretty awesome after Jefferson worked on it for forty years.Monticello was built on a mountaintop near Charlottesville, Virginia, in a neoclassical style.Can you believe how long it took Jefferson to build his house? Standard form for -3x^+ x=13