Ship A sights ship B on a bearing of 308°. What is the bearing of A from B?


I need an explanation on how to do this please. I just learned this but I'm still confused.
Oh, and if you can, please include a picture!
Thank you!

Answers

Answer 1

Answer:

128°

Step-by-step explanation:

the answer is 128° i explained it as i could in the diagram hope you understand

Ship A Sights Ship B On A Bearing Of 308. What Is The Bearing Of A From B?I Need An Explanation On How

Related Questions


Some one help please fast help ASAP

Answers

Answer: (x, y) --> (x, -y)

Step-by-step explanation:

This is a reflection over the x-axis so its only the y-intercept that changes.

Answer:

its a reflection

Step-by-step explanation:

If it were a rotation, it wouldnt have overlapped.

If it were a translation, It would have been the wrong way up and not overlapping.

When reflected over line x, it will overlap because it stays rigid and does not change shape or size.

hope this helps :)

The temperature is -2 °C. If the temperature rises by 15 °C, what is the new temperature?

Answers

Answer:

The answer is 13°C because 15-2 gives you 13

Step-by-step explanation:

Can someone help with this I’ll probably give you brainliest. It is due at 11:59 pm January 21st

Answers

Answer:

1. x^2-5

2. 13x+3

3. Add −5 and 3

2x−13x-2

hope this helps!!:)

Step-by-step explanation:

What is the measure of the missing angle in this triangle?
25°
155
35°
60°

Answers

Answer: im just going to guess 35 degrees

Step-by-step explanation:

Answer:

its 25

Step-by-step explanation:

35+120 =155

180 (the sum of a triangle) - 155 = 25

missing triangle equals= 25

to check= add the 3 triangles together, if the sum adds up to 180 its correct.

125+35+25= 180 √

Simplify the expression

6s-6s=?

Answers

Answer:

0

Step-by-step explanation:

6-6=0 so when you multiply s by 0 its 0

Find the area of the polygon.

Answers

Make a box thats 32x20
32x20=640 square ft for box 1
For box 2 ||
40-32= 8
16x8= 128 square ft for box 2
For triangle 3
20-16=4
Has dimensions of 8x4|| divide by two to the t the area of a triangle
(8x4)/2 = 16 square fr
16+128+640= 784 square ft total

Plz help its really urgent!!

Answers

Answer:

3)0.4 and 1.8

Step-by-step explanation:

:):):):):):):);):):)

4x2 - 7 + 2x - 3x² + 8x - 6

Answers

Answer:

(4x2 - 2x) - (-5x2 - 8x)

= 4x2 - 2x + 5x2 + 8x.

= 4x2 + 5x2 - 2x + 8x.

= 9x2 + 6x.

= 3x(3x + 2).

Answer: 3x(3x + 2)

Step-by-step explanation:

What is the slope of the line that contains the points (-4, 2) and (6, -3)?

Answers

Answer:

-1/2 or [tex]-\frac{1}{2}[/tex]

Step-by-step explanation:

to find the slope, use the formula

(y₁ - y₂)/(x₁ - x₂)

(2 - -3)/(-4 - 6)

(2 + 3)/(- 4 - 6)

5/-10

1/-2

-1/2

Write an algebraic expression for each verbal description:

The number of people who do NOT have brown hair
b= number of people WITH brown hair

Answers

90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say i love you

2.) A car rental company is charging a
$50 rental fee and then $0.17 per mile.
.
Write an expression that represents the
total cost of renting a car for a day using
m for number of miles.
If Kane traveled 55 miles, how much
did his trip cost?

Answers

Answer:

y=0.17x+50.   His trip cost $50.85

Step-by-step explanation:

A birdwatcher recorded how many birds were in two different parks each day for four days. The data is shown in the table.
Day
1 | 2 | 3 | 4
Park A 10 12 14 16
Park B 2 4816
Move options to the blanks to compare how the bird population is growing at each park.
Each day, the number of birds in Park A grows by
Each day, the number of birds In Park B grows by
If this pattern continues after day 4. Park
will always have more birds.
an increasing amount
a decreasing amount
the same amount
А
B

Answers

Answer:

Step-by-step explanation:

what’s the answer?

Find the length of the missing side

Answers

Answer:

c²=a²+b²

17²=289

10²100

a=√(17²-10²)

so 289-100=189

square root answer

=13.7477270849

Answer:13.75

A brownie recipe requires 4 cups of flour for 6 persons how much flour do you require for 24 persons

Answers

It requires 24 cups for 24 people I believe 6•4=24

Y'all I kinda need help in this problem​

Answers

Answer:

4

Step-by-step explanation:

15km in 1 hour

60 minutes in 1 hour

60 min/15km

4 min per km

Andres has $7 he needs $50 to buy a skateboard each week his grandmother pay him $4 to complete some chores

Answers

Answer:

she has to give him 4 dollars each week for 11 weeks since he already has 7 dollars.

Step-by-step explanation:

4 x 11 = 44 +7 = 51 so now he had enough for a skateboard.

help me find the area :)

Answers

Answer:

20.625 ft²

(hope this is right :)

Find the slope and the -intercept of the line. y=-1/5x+7 plz i need help

Answers

Answer:

slope= -1/5

y-intercept=7

Step-by-step explanation:

y=mx+b is a linear equation

m=slope

b=y-intercept

12. A culture of bacteria in the lab doubles every 6 minutes. Assume the growth follows a continuous exponential
model and you start with only 2 bacterium.
Using an appropriate exponential base, if this pattern continues to be applicable, find the time in
which the number of bacteria would reach 109. (Round to the nearest minute.)

Answers

Answer:

18 minutes

Step-by-step explanation:

if you divide 109 by 6, ya get 18.166666-

100) Reflect the point in (a) the x-axis and (b) the y-axis.
36. (4,1)
37. (-2,3)
38. (2, -5
39. (-3.5, -2.5) ​

Answers

Answer:

Step-by-step explanation:

36. (4,1)

x-axis(4,-1)

y-axis(-4,1)

37.(-2,3)

x-axis(2,-3)

y-axis(-2,3)

38.(2,-5)

x-axis(-2,5)

y-axis(2,-5)

39.(-3.5, -2.5)

x-axis(-3.5,2.5)

y-axis(3.5,-2.5)

Please correct me I am wrong

Here is the y-axis formula (-x,y)

Here is the x-axis formula(x,-y)

HELP

What is the domain of the equation graphed below

Answers

Answer:

The domain of a function is the range of which the x-axis spans across the function. Range is the range of which the y-axis spans across the function. You can see here, there is not stoping point on either side of the function, meaning that the function reachest from -infinity to +infinity. So you answer would be:

B) All Real Numbers

Hope that I helped!

Yellow Cab Taxi charges a $1.75 flat rate in addition to $0.75 per mile. Katie has no more than $10 to spend on a ride. How many miles can Katie travel without exceeding her limit?

Answers

Answer:

11 miles

Step-by-step explanation:

10-1.75=8.25

8.25÷.75=11

What is standard deviation for 110 120 120 130 140 140 150 160 160 170

Answers

Answer:

Standard Deviation (cont’d)Weights(pounds):110 120 130 140 150 150 160 170 180 190Deviation scores(x) forM = 150:-40 -30 -20 -10 0 0 10 20 30 40 Squared deviation scores(x2):1600 900 400 100 0 0 100 400 900 1600Sum of squared deviation scores:1600+900+400+100+0+0+100+400+900+1600 = 6000SD= √(6000/(N-1) = SD= √(6000/(9) = 25.82Standard Deviation Interpretation•Provides a “standard”—the SDindicates the average amount of deviation of scoresfrom the mean•Tells you how wrong, on average, the mean is•An SDprovides valuable information when the distribution is normal:–There are approximately three SDsabove and below the meanin a normal distribution•In a normal distribution, a fixed percentage of cases lie within certain distances from themeanSDs and Individual Scores•A person who scores one SDbelow the mean has a higher score than 16% of the cases (2.3% + 13.6%)•A person who scores one SDabove the mean has a higher score than 84% of the cases (50.0% + 34.1%)Example: Midterm marks:

Find a solution for
-2/9 = 4/m

Answers

I think its -18

Step-by-step explanation:

-2/9 = 4 /m

-2 ×-2 = 4

so you would do the same to the bottom

9 ×-2 = -18

sorry if I'm wrong

Using the diagram below, find the length of BC.

Answers

the answer would be 46.3

What is 3.016 written in words?

A Three and sixteen tenths
B Three and sixteen hundredths
C Three and sixteen thousandths
D Three and sixteen ten-thousandths

Answers

Answer C (Three and sixteen thousandths)
C. Three and sixteen thousands

A mountain climber ascends 800 feet per hour from his original
position. After 6 hours, his final position is 11,600 feet above sea
level. Find the climber's original position,

Answers

Answer:

4,800

Step-by-step explanation:

Just multiply 800 x 6, which gets 6,800. Then, get 11,600 and subtract 6,800 from it. You'll get 4,800.

Please help!! Why is sin(20) = sin(160) = -sin(200) = -sin(340)?

Answers

These relations all follow from the identity,

sin(x - y) = sin(x) cos(y) - cos(x) sin(y)

Notice that 160° = 180° - 20°, so if x = 180° and y = 20° above, we get

sin(160°) = sin(180°) cos(20°) - cos(180°) sin(20°)

We know sin(180°) = 0 and cos(180°) = -1, so we end up with

sin(160°) = sin(20°)

For the other, notice that 200° = 360° - 160°, and 340° = 360° - 20°.

Answer:

Step-by-step explanation:

sin 20 is the same as sin 60 because 180-60=20. sin 20 is the same as -sin200 because 200-180=20

sin 340 is the same as sin 20 because 360-340=20. So all four of these connect and they all equal 20. Also, they all equal .3420 (rounded)

A regular octagonal pyramid. Each side of the base is 6 cm long. it has a height of 10cm. Find the surface area of the pyramid​

Answers

9514 1404 393

Answer:

  470.16 cm²

Step-by-step explanation:

The apothem of the base is used for two purposes: to find the area of the base, and to find the slant height of each face.

The apothem of the base for side length s is ...

  s/2 = a·tan(π/8)

  a = s/(2·tan(π/8)) ≈ 7.24 cm

The slant height of a triangular face is found using the Pythagorean theorem. The apothem of the base and the height are legs of the right triangle whose hypotenuse is the slant height. For slant height x, we have ...

  x² = 10² + a² = 100 +52.46

  x ≈ √152.46 ≈ 12.35

__

The area of the 8 triangular faces will be ...

  A = 1/2Px . . . . where P is the perimeter of the pyramid

The area of the base will be ...

  A = 1/2Pa

So, the total surface area is ...

  A = 1/2P(a + x) = (1/2)(8)(6 cm)(7.24 +12.35 cm) ≈ 470.16 cm²

The answer is 470.16 cm²

What’s the solution for x-0= 0

Answers

i’m pretty sure it’s 0
Other Questions
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make? You know I never approved of it, pursued Utterson, ruthlessly disregarding the fresh topic.My will? Yes, certainly, I know that, said the doctor, a trifle sharply. You have told me so.Well, I tell you so again, continued the lawyer. I have been learning something of young Hyde.The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. I do not care to hear more, said he. This is a matter I thought we had agreed to drop.The Strange Case of Dr. Jekyll and Mr. Hyde,Robert Louis StevensonWhere in the plot is this passage found?the expositionthe rising actionthe falling actionthe resolution How do blood types react in a transfusin ? plz help me with this 1) Choose the correct answer. I NEED HELP ASAPThe destination of many Roman Catholic pilgrimages was ______.the Holy Landthe Holy Roman EmpireAfricaKievRome The incidence of cystic fibrosis, a recessive genetic disorder in the Caucasian population of United States, is 1 in every 2,500 individuals. Find the number of heterozygous carriers. (p + q = 1, p2 + 2pq + q2 = 1) An appropriate strategy to learn difficult vocabulary words is the a. Keywords technique c. Rhyming Technique b. Visualization technique d. None of these Please select the best answer from the choices provided A B C D What must occur to produce electric current? Which atom is involved in giving your heart energy to beat? O carbonO gold O oxygenO iron wut anime do u guys watch comment down below and you'll get brainliest as well 2x2 just in case it would deleted i will also put math equations 2x3x4x5 Need help finding x. What determines which bases will be brought to the DNA strand during DNA replication? HELP WITH MATH PLSSSSSSSSSSSSS Plz helpEnglish hw How did betsy change Washington's design Summarize in 2-3 sentences, how an RNA vaccine works to help protect you againstviruses?I