Step By Step please & Thank you.

Step By Step Please & Thank You.

Answers

Answer 1

Answer:

2/3

Step-by-step explanation:

[tex] \frac{3}{4} n = \frac{1}{2} \\ \\ multiply \: both \: sides \: by \: \frac{4}{3} \\ \\ \frac{ \cancel4}{\cancel3} \times \frac{\cancel3}{\cancel4} n = \frac{\cancel4 \: \: \red{ \bold2}}{3} \times \frac{1}{ \cancel2} \\ \\n = \frac{2 \times 1}{3 \times 1} \\ \\ n = \frac{2}{3} [/tex]

Answer 2
I agree. The answer is 2/3

Related Questions

(50pts)Solve for x:

a

7.125
b

6
c

8
d

4.125

Answers

Answer:

b. 6

Step-by-step explanation:

[tex](16x + 9) \degree = 105 \degree \\(corresponding \: \angle s) \\ \\16x + 9 = 105 \\ \\ 16x = 105 - 9 \\ \\ 16x = 96 \\ \\ x = \frac{96}{16} \\ \\ x = 6[/tex]

The correct answer is 6

what is 4855/200 simplified

Answers

Answer:

The answer is 2427.5

Step-by-step explanation:

The fraction consists of two numbers and a fraction bar: 4,855/200

The number above the bar is called numerator: 4,855

The number below the bar is called denominator: 200

The fraction bar means that the two numbers are dividing themselves.

To get fraction's value divide the numerator by the denominator:

Value = 4,855 ÷ 200

To calculate the greatest common factor, GCF:

1. Build the prime factorizations of the numerator and denominator.

2. Multiply all the common prime factors, by the lowest exponents.

Factor both the numerator and denominator, break them down to prime factors:

Prime Factorization of a number: finding the prime numbers that multiply together to make that number.

4,855 = 5 × 971;

4,855 is a composite number;

In exponential notation:

200 = 2 × 2 × 2 × 5 × 5 = 23 × 52;

200 is a composite number;

16 is a factor of 24.
O A. True
O B. False

Answers

The answer is b/false I hope this help
false, the factors of 24 are 1, 2, 3, 4, 6, 8, 12, 24

Please help!!!!!!!!!!!!!! I need help please!!!!!!

Answers

Answer:

c

Step-by-step explanation:

Answer:

It would be c

Step-by-step explanation:

Have a nice day!

HW HELP ASAPP
+10PTS

Answers

Answer:

It will be 144 in total my dear Ur cute btw

Step-by-step explanation:

144 should be the correct answer for the equation

i giveee brainlilsttt

Answers

Answer:

-5,1

Step-by-step explanation:

hope that helps

:))))))

(-7-3i)(11-8i)
Simplified into the a+bi form

Answers

Answer: what

Step-by-step explanation:

Rita earns 44dollars each week working part-time at a bookstore. She earns one additional dollar for each book that she sells.
Let A be the amount (in dollars) that Kala earns in a week if she sells B books.
Write an equation relating A to B. Then use this equation to find the amount of money Rita earns if she sells 35books.
Equation:
Amount Rita earns if she sells 35books: dollars

Answers

Answer 1: 44 + B = A
44 + (35) = A
Answer 2: 44 + 35 = $79

please help y'all no matter what I do I cannot figure this out please help what number would you add to both sides to complete the square in this trinomial x ^ 2 + 6x = -5 and the options are 6 , 9 , 12 and please show how you did it so I can figure out the rest of my homework ​

Answers

Answer:

Im sorry im not sure

Step-by-step explanation:

What is the common factor of 26 and 38

Answers

Answer: The GCF is 2 and the LCF is 1

Step-by-step explanation:

A standard train ticket in a certain city costs $1.50 per ride. People who use the train also have the option of purchasing a frequent rider pass for $17.25 per month. With the pass, a ticket costs only $0.75 per ride. How many train rides a month make the frequent rider pass a better deal than standard train tickets?

Answers

Just off the bat 17$is 12 rides and then 17.25 +0.75 is 18 so 13 rides

x = number of rides per month.

Without the pass, the cost per ride is 2.00 per ride.

With the pass, the cost per ride is 1.25 per ride plus 15.75 per month.

You want to know at what number of rides does the cost per ride using the pass become cheaper than the cost per ride without using the pass.

The formula for total cost is as follows:

without the pass:

C1 = 2*x

with the pass:

C2 = 15.75 + 1.25*x

You want to know when C2 becomes less than C1.

C2 < C1 is the inequality equation you are looking for.

Since C2 = 15.75 + 1.25*x, and C1 = 2*x, this equation becomes:

15.75 + 1.25*x < 2*x

Subtract 1.25*x from both sides of this equation to get:

15.75 < 2*x - 1.25*x which becomes:

15.75 < .75*x

Divide both sides of this equation by .75*x to get:

15.75/.75 < x

Simplify to get:

21 < x

21 < x is the same as x > 21.

Your answer is the C2 becomes cheaper than C1 when x > 21.

If you make x = 21, then:

C1 = 2*21 = 42
C2 = 15.75 + 1.25*21 = 15.75 + 26.25 = 42

They are equal.

If you make x = 22, then:

C1 = 2*22 = 44
C2 = 15.75 + 1.25*22 = 15.75 + 27.5 = 43.25

43.25 is cheaper than 44 so C2 is cheaper than C1, confirming that the equation is good.

What is the slope of the line y = 7x + 3
-?
1
7
А
B
7
3
8
8
3

Answers

Answer:

7 :)

Step-by-step explanation:

I will give you a good amount of points if you answer this correct​

Answers

Answer:

I think the answer is B. The equation has infinitely many solutions.

Step-by-step explanation:

4(3x + 4) = 15x + 12 - 3x + 4

*group like terms so 4(3x+4) = 15x - 3x + 12 + 4

*add similar elements 15x - 3x = 12x

*add the numbers 12 + 4 = 16

*Expand to 12x + 16 - 16 = 12x + 16 - 16

*You simplify 12x = 12x

*Subtract 12x from both sides

*Then Simplify which is 0

Which means Both sides are equal to 0

True for all X

Write an expression that represents the number of shells in pile 2.

Answers

Answer:

2

Step-by-step explanation:

4/2=2

800 adults were surveyed to find out how many notes per week they cook dinner 60% indicated that they cooked dinner more than four nights at per week based on the results of the survey how many adults out of a group of 2000 to cooked dinner more than four nights per week

Answers

Answer:

1200

Step-by-step explanation:

60                 x

-              =    -

100               800

There are 2 ways to solve this.

1) 800 x 60= 48,000

Divide by 100= 480

x=480

2)  Multiply 60 by 8.

Now there are another 2 ways to go.

1) 480        x

   -        =   -

  800        2000

OR

2) 60            x

   -          =    -

   100           2000

I recommend the second option for both. It is easier. The second option allows you to find and equal ratio, with less of the hassle.  

To get 2000, 100 must be multiplied by 20. So.... multiply 60 by 20 to get a equal ratio.

Your answer is 1200. Meaning 1200 adults cooked dinner more than four nights per week.

I hope this helps you significantly

~~~LampteyJ

Answer:

1200

Step-by-step explanation:

Please help ASAP!! 20 points givin

Answers

Answer:

d or b

Step-by-step explanation:

quick math

Answer is A 5/3
Hope it helps :)

What is the opposite of the opposite number located at point b? A) −2 B) −1 2 C) 2 D) 1 2​

Answers

Answer:

Hope it help

Step-by-step explanation:

Letter c

Annabelle drove 155 miles in 5 hours. How many miles does she drive in 4 hours? How many miles does she drive in 6 hours?

Answers

She drives 124 miles in 4 hours and 186 miles in 6 hours.

7 1/2 + X + 15? What is X?

Answers

Answer;
22.5
Explanation;
7 1/2 + 15
-22.5

7.5+15+x=0
22.5+x=0
x= -22.5

Pls help urgently extra points and mark brainlist

Answers

Answer:

You got it right it is the second option

Step-by-step explanation:

I'm trying to level up and need 3 more brainliest so if possible can you mark me brainliest if not that's ok! :)

Answer: the last one

Step-by-step explanation:

Determine whether the system of linear equations has one and only one solution, infinitely many solutions, or no solution.

Answers

Answer:

only one solution

Step-by-step explanation:

Complete question:

Determine whether the system of linear equations has one and only one solution, infinitely many solutions, or no solution. 2x − y = 2 3x + y = −6 one and only one solution infinitely many solutions no solution Find the solution, if one exists. (If there are infinitely many solutions, express x and y in terms of the parameter t. If there is no solution, enter NO SOLUTION.) (x, y) =

Given the expression

2x − y = 2 .... 1

3x + y = −6  ..... 2

We are to determine the number of solution the equation has:

Add equation 1 and 2

2x + 3x = 2 - 6

5x = -4

x = -4/5

Substitute x = -4/5 into 1

From 1: 2x − y = 2 .... 1

2(-4/5) - y = 2

-8/5 - y = -2

-y = -2+8/5

-y = -10+8/5

-y = -2/5

y = 2/5

Since the value of x and y are just 1 hence the system of equations has ine solution

Question 16 please help me

Answers

The answer is 32.8 this is because using the Pythagorean it’s a”

Is anyone here good at calculus I’m willing to pay.

Answers

what level calculus?

When are two lines perpendicular?

A. when the slopes are opposites
B. when the slopes are reciprocal
C. when the slopes are negative
D. when the slopes are opposite and reciprocal​

Answers

Answer: C I think

Step-by-step explanation:

Hello :)
Please help me solve this

Explain answer

Answers

Answer:

A. Store A will cost about $1.28 less

Step-by-step explanation:

Store A:

Unit rate = y/x

Using any given pair, say (3, 7.26),

Unit rate = 7.26/3 = $2.42 per gallon

So, of a customer is buying 16 gallons at Store A, he'd pay:

$2.42 * 16 = $38.72

Store B:

Unit rate = y/x

Using any point on the graph, say (20, 50),

Unit rate = 50/20 = $2.5 per gallon

So, of a customer is buying 16 gallons at Store B, he'd pay:

$2.5 * 16 = $40.

Cost of Store B - Cost of Store A = $40 - $38.72 = 1.28

This means that Store A cost about $1.28 less

What is
12а + 7x - За – 2х

Answers

Answer:

=12a-3a+7x-2x

=9a+5x

This is the answer.

Hope it helps you..

Answer

=12a+7x-3a-2x

=9a+7x-2x

=9a+5x

Explanation

This is the ans. hope you like it....

It is not possible to divide 22 by 0 because there is no you can ______ by 0 and get 22.

A. multiply
B. add
C. subtract
D. divide

Answers

Answer:

divide

Step-by-step explanation:

divide

..........................

Answer:

its A.multiply

Step-by-step explanation:

if you cannot divide than you cannot multiply

1-i need to mix 25% mineral spirits to the varnish i am using what ratio of spirit to varnish am i using? 2-if i use 240 ml of varnish what quantity of mineral spirits will i need in ml ? 3-Robison's tapestries all measure 1.5m x 1m wide. Express the proportion of the tapestries' heights to width using whole numbers. Give the answer in ration.

Answers

Answer:

(1) The required ratio of spirit to varnish is 1:3.

(2) You need 80 ml of mineral spirit.

(3) The ratio of tapestries' heights to width is 3:2.

Step-by-step explanation:

(1) If you need to mix 25% mineral spirit to the varnish, then the solution would contain 25% mineral spirit and 75% varnish.

So, [tex]\frac{spirit}{varnish}=\frac{25}{75}[/tex]

                  [tex]=\frac{1}{3}[/tex]

Thus, The required ratio of spirit to varnish is 1:3.

(2) If you use 240ml of varnish, then this quantity is 75% of the total solution or ration of varnish to the total solution will be 3:4.

Let [tex]x[/tex] be the quantity of total solution.

Then, [tex]240:x=3:4[/tex].

⇒[tex]\frac{240}{x}=\frac{3}{4}[/tex]

⇒[tex]3x=240*4[/tex]

⇒[tex]x=\frac{240*4}{3}[/tex]

⇒[tex]x=320[/tex]

That is, total solution is 320 ml.

Now, Spirit = Total solution - Varnish

⇒Spirit = 320ml-240ml

⇒Spirit = 80ml

Hence, if you use 240 ml of varnish, you need 80 ml of mineral spirit.

(3) Robison's tapestries all measure 1.5m long and 1m wide. First, we express dimensions in whole numbers by multiplying them by 10.

Then, dimensions are 15m long and 10m wide.

Now, Height : Width = 15:10

⇒[tex]\frac{Height}{Width} =\frac{15}{10}[/tex]

⇒[tex]\frac{Height}{Width} =\frac{3}{2}[/tex]

Hence, the ratio of tapestries' heights to width is 3:2.

joe used 20 gallons of gas to go 300 miles. At this rate, how much gas must he use to go 3500 miles?
STEP BY STEP ASAP PLEASE ITS EQIVALENT RATIO

Answers

Answer:

400 miles se tiene que multiplicar y sumar

what assumption have you made in answering part b​

Answers

You're assuming that this data set represents all of Mrs. Hassaan's pupils. Certain students could be missing from the histogram - for instance, there could be one or two students who missed the test, but for certain reasons will be taking a make-up exam. Their grade would not be recording in this data set, but they still contribute to the class size, and so would be unaccounted for here.

Other Questions
which is the correct graph for the equation? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Bryan wants to buy a new pair of jeans. If the jeans were originally $45.00, but are on sale with a 20% discount, how much will Bryan have to pay for the jeans? MR. ARCEO TAKES A TAXI FROM THE AIRPORT TO A HOTEL. THE TAXI CHARGES $2.50 INITIAL CHARGE PLUS $2.65 PER MILE. WHICH EQUATION CAN BE USED TO FIND Y, THE TOTAL COST OF THE TRIP, IF X REPRESENTS THE NUMBER OF MILES OF THE TRIP? Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? how is a job search conducted One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia What is greater -3.2 or -3 2 MATH K.Parker is trying to solve the addition problem below.58 +36 =Drag and drop the numbers below to complete each sentence.Is and PlaceParker will need to change!ones intoten andones. The answer to the addition probleman and1000is 58 +36 =945 - Part 12.: 3:: 5:: 13:: 14:: 15! 84s - Part 2Next2 of 13Copyright 2020 Edmentum, Inc. All Rights ReservedPrivacy Policy California Privacy Rights Contact10:3 List two equivalent numbers to 0.50 Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make? You know I never approved of it, pursued Utterson, ruthlessly disregarding the fresh topic.My will? Yes, certainly, I know that, said the doctor, a trifle sharply. You have told me so.Well, I tell you so again, continued the lawyer. I have been learning something of young Hyde.The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. I do not care to hear more, said he. This is a matter I thought we had agreed to drop.The Strange Case of Dr. Jekyll and Mr. Hyde,Robert Louis StevensonWhere in the plot is this passage found?the expositionthe rising actionthe falling actionthe resolution Tell whether the triangle is right or not 1. (04.04 HC)Lee y escoge la mejor respuesta. Read and select the best answer.Hoy en da, hay muchos estudiantes que estn perdiendo algo muy importante y profundo en su educacin. Esta es la presencia de la msica y el arte en las escuelas. El estudio del arteayuda a enriquecer a los estudiantes y exponerlos a otras culturas y perspectivas. Estas experiencias ayudan a prepararlos para el futuro. Deberamos gastar ms dinero en el arte y no soloen las ciencias y las matemticas.(1 point)Segn la lectura, que podra ser un gancho para esta lectura? Un gancho para esta lectura podria serO el arte no debera estar en la escuelaO qu es el arte para ti?O cul es el valor de una educacin artstica?O solamente las ciencias y las matemticas How do blood types react in a transfusin ? Tarshiss article is mainly about A. the U.S. Navys secret missions B. the construction of the Titanic C. creatures that thrive in the deep seaD. one mans quest to find the Titanic Which algebraic expression could NOT represent the phrase below?"Four more than the product 3 times the number of c cats"A: 4 + 3 cB: (4+3)cC: 3 x c + 4 D: (3 x c) + 4Select one. pls explain how to do this There were 45 runners sister erased in the first half of the race 2/3 of them dropped out in the second half of the race to fifth of the remaining runners chopped out how many runners finish the race