The implication x => y is equivalent to ??​

Answers

Answer 1

y <= x

Hope this helps! :)

Answer 2
Y=m I hope this helps you!’

Related Questions

Joseph has 22 gallons of fertilizer. He uses 7 quarts to fertilize his plants.

How many quarts of fertilizer are left?

Answers

Answer:

81

Step-by-step explanation:

4 quarts = 1 gallon

there are 22 gallons so multiply 4 by 22

that equals 88 quarts then subtract 7

leaving you with 81 quarts

give one example of the following properties for whole number under addition​

Answers

Step-by-step explanation:

Objective: Recall the properties.

a) 3+1=4

b) 3+7=7+3

c) 3+(7+4)=7+(3+4)

d). 3(7+4)=(3×7)+(3×4)

Do they take your phones and watch you take the cumulative test on edginuity?

Answers

Answer:

I don't know what your school is doing but what happened to me was that I just waited for the test to be unlocked and I was working from home so I was able to keep my phone and I didn't need to be in a meeting

A rectangular countertop has an area of 10 square feet. Its perimeter is 14 feet. What are the
dimensions of the counter?

Answers

Length- 5 feet
Width- 2 feet
Explanation:
If you were to check this answer:
Area of rectangular counter is length•width:
5 feet • 2 feet = 10 square feet (correct)

Perimeter of rectangular counter is 2 (l + w) :
2 ( 5 + 2 ) = 14 (CORRECT)

PLS SAY IF MY ANSWER WAS RIGHT!
if it is, brainliest please!
Com.ment me if u have any questions
-SpaceMarsh, have a nice day

HELP ASAP!!!
(Question and answers pictured)

Answers

9514 1404 393

Answer:

  (d)  reflection about the x-axis, up 6 units

Step-by-step explanation:

The parent function y=1/x is multiplied by -1, which reflects it over the x-axis. Then 6 is added, which shifts it up 6 units.

The transformations are ...

  reflection about the x-axis, up 6 units

what is (2²)×(2²)‐³ when simplified​

Answers

Step-by-step explanation:

Everything has been written ..

About 5% of the population has a particular genetic mutation. 200 people are randomly selected.

Find the mean for the number of people with the genetic mutation in such groups of 200.

Answers

Answer:

ok 200 we have to find 5% of 200 so since 200 is doable 100 we just multiply 5 by 2 to get 10

so out of the 200 people 10 of them have the mutation

Hope This Helps!!!

Help me pls find this answer I doubt mine is right ​

Answers

Answer:

whats the question?

comment so i can help:)

QUESTION AT THE BOTTOM MAKE SURE YOU KNOW THE ANSWER FIRST PLAESE

Answers

Answer:

V=πr2h /3

so we just substate and we get

V≈130.9

Answer: 130.83 units cubed

Step-by-step explanation:

The formula for finding the volume of a cone is [tex]\pi r^2\frac{h}{3}[/tex]

We will use 3.14 for pi.

[tex]3.14r^2\frac{h}{3}[/tex]

Now let's sub in our variables and solve

[tex]3.14(5^2)(\frac{5}{3})\\3.14(25)(\frac{5}{3})\\78.5(\frac{5}{3})\\130 \frac{5}{6}[/tex]

5/6 is about .83

130.83

x^ 3 + 3 x ^ 2 - 9 x - 27 draw the graph of the first derivative and the second derivative on the same set​

Answers

Answer:

The graph is in the second attached image.

Step-by-step explanation:

In the first attached image, you have three equation graphed, the first is in red color, it's the original equation:

x^3 + 3x^2 - 9x - 27

I graphed this to obtain a clear relation between the equation and its derivatives, the second graphed equation is in blue color and it's the first derivative:

First derivative = 3x^2 + 6x - 9 (It's a parabola)

And at last, we have in green color the second derivative:

Second derivative = 6x + 6 (It's a line)

As you can see, you only need the first and the second derivatives in the exercise, by this reason, in the second attached image you have the graph as you need to show in this exercise.

what is the derivative of y=(x^2√(1+x))/((1+x^2)^3/2))

Answers

Step-by-step explanation:

Maple calculator used.........................

Answer:

Step-by-step explanation:

[tex]f(x)={x^2\sqrt{1+x}\over{(1+x^2)^{3\over{2}}}}\\\\f^\prime (x)=\frac{{{(x^2\sqrt{1+x})^\prime (1+x^2)^{\frac{3}{2}}+ (x^2\sqrt{1+x})}((1+x^2)^{\frac{3}{2}}})^\prime}{((1+x^2)^\frac{3}{2})^2}}}[/tex]

[tex](x^2 \sqrt{1+x})^\prime=2x\sqrt{1+x}+ \frac{x^2}{2\sqrt{1+x}}[/tex]

[tex]((1+x^2)^{\frac{3}{2}})^\prime=\frac{3}{2}(1+x^2)^{\frac{1}{2}} (2x)=3x(1+x^2)^{\frac{1}{2}}[/tex]

[tex]f^\prime(x)=\frac{\{(1+x^2)^{\frac{3}{2}}\}(2x\sqrt{1+x}+\frac{x^2}{2\sqrt{1+x}})+(x^2 \sqrt{1+x})(3x\sqrt{1+x^2})}{(1+x^2)^{3}}}[/tex]

[tex]\sqrt{1+x^2}=\sqrt{(1+x)(1-x)}[/tex]

[tex]f^\prime (x)=x\sqrt{1+x}~\frac{(1+x^2)^{\frac{3}{2}}(2+\frac{x^2}{2(1+x)})+3x^2\sqrt{1-x}}{(1+x^2)^3}[/tex]

Which statements are correct? Check all that apply.

Answers

Answer:

E is the subset of I

S is the subset of T

R ⊂ P

Step-by-step explanation:

PLEASE ANSWER ASAP FOR BRAINLEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

I say number 2 idrk so I hope I helped >-<

I believe it’s 2/3 because there are 2 different events happening

The following are the Pulse Rates of the 12 students in a Math Class

76 60 59 60

81 72 91 80

80 68 73 77



If we create Classes for a relative frequency distribution.

For the Class 50-59 , find the frequency

Answers

Answer:

1

Step-by-step explanation:

Given the pulse rate for 12 students :

76 60 59 60 81 72 91 80 80 68 73 77

Creating class intervals ::

Width = 10

59, 60, 60, 68, 72, 73, 76, 77, 80, 80, 81, 91

Interval ____ Frequency

50 - 59 ______ 1

60 - 69 ______ 3

70 - 79 ______ 4

80 - 89 ______ 3

90 - 99 ______ 1

Frequebcy if the 50 - 59 class interval is 1

a total of 10000 was invested in two business ventures A and B .at the of the first year A and B yielded returns of 6% and 23÷4 respective on the original investment how was the original amount allocated if the total amount earned was 588.75?​

Answers

Answer:

(1)

compound amount = 802.5 $

invest earned = 52.5 $

Step-by-step explanation:

total amount = 10000 $

let amount x invested in ventures A and remaining (1000-x) on ventures B

now,

6x/100 +23/400(1000-x ) = 588.75

{24x+23(1000-x)}/400 =588.75

x=235500-230000

x=5500

Amount invested on A = 5500$

Amount invested on B = 4500$

(2)

principle=750$

time= 1 year

effective invest rate = 7%

a) compound amount = p(1+(r/w)^t

=750{1+(7/100)}^1

=802.5$

b) invest earned = 802.5-700 = 52.5$

Seven times a number decreased by three-fourths of the same number is 25. What is the number?

Answers

Answer:

The number is four (4)

Step-by-step explanation:

look at the picture above, it explains everything

What is the area, in square units, of triangle STU?

Answers

9514 1404 393

Answer:

  14.5 square units

Step-by-step explanation:

There are several methods for finding the area of an acute scalene triangle with mostly irrational side lengths. Here's one.

Define X(4, 2) and Y(9, 2). The trapezoid XUTY has bases XU=9-2=7 and TY=6-2=4. Its height is XY=9-4=5, and its area is found from the formula ...

  A = 1/2(b1 +b2)h

  A = 1/2(7+4)(5) = 55/2 = 27.5

The area of our triangle is this trapezoid's area less the areas of triangles XUS and YTS. Those areas can be found from the formula ...

  A = 1/2bh

  ∆XUS area = 1/2(2)(7) = 7

  ∆YTS area = 1/2(3)(4) = 6

So, the area of ∆STU is ...

  area STU = area XUTY -area XUS -area YTS = 27.5 -7 -6

  area STU = 14.5 . . . square units

Answer:

the Guy above me is right ig....... To solve the problem just find the length of the 2 shorter sided than  add an exponent of 2 to all the numbers, then add, then square it

Step-by-step explanation:

Question 6. * The number of likes a social media post has generated has been tracked as a function of the number of min since it was posted. The data is shown in the table below, where t is the number of minutes and I is the number of likes. If an exponential model was used to fit this data, which of the following would be closest to its prediction for the number of likes after one hour

Answers

Answer:

Step-by-step explanation:

yes

The total number of goals scored in a hockey game was 20. Team B scored 4 more goals than team A. How many goals did each team score?

Answers

Answer:

Team B 12 goals, Team A 8

Step-by-step explanation:

Equation 2x +4 = 20

2x = 16

x= 8

Answer:

A:8 B:12

Step-by-step explanation:

using long division what is the quotient of this expression?

Answers

Answer:

A

Step-by-step explanation:

Answer:

Answer is A

Step-by-step explanation:

Please help I need your math skills I need to answer this or my teacher won’t add my picture in the year book slide-show!

Answers

A answer b                      B answer c

Step-by-step explanation:

3x(x-y)-p(y-x) factorise by taking out the common factor​

Answers

Answer:

Rewrite as

3x(x-y) -p[-(x-y)]

We factored out a minus from the second bracket. I chose the second bracket arbitrarily... You can chose the 1st bracket if you want.

Now when those two minus interact... They became Positive(From rules of sign Multiplication)

3x(x-y) + p(x-y)

Now factor out (x-y) from both

(x-y) [ 3x + p]

So that's our answer!!

(x-y)[ 3x + p ].

Classify the angle pairs

Answers

Answer:

Alternate exterior

Step-by-step explanation:

Angles 2 and 7 are on exterior sides of the transversal and also are opposite to one another. They are classified as alternate exterior.

Answer:

alternate exterior angles

Step-by-step explanation:

2 and 7 are on opposite sides of the transversal so they are called alternate

They are on the outside of the parallel lines so the are called exterior

Which of the following are true statements using the Associative Property of Multiplication?
(a – b) – c = a – (b – c)
a(b + c) = ab + ac
a(bc) = (ab)c
(a + b) + c = c + (a + b)

Answers

9514 1404 393

Answer:

  a(bc) = (ab)c

Step-by-step explanation:

The associative property of multiplication says the product is the same regardless of how the factors are grouped. That is demonstrated by the equality ...

  a(bc) = (ab)c

the washington monument in washington d.c is 555 feet tall. If a tourist sees the monument with a viewing angle of 8, how far away, to the nearest foot, is she from the monument?

Answers

Answer:

3,964 ft

Step-by-step explanation:

555 / tan 8° = 555/0.14 = 3,964 ft

3.(8 points)Consider the following experiment:Experiment: A bag contains 3 red balls, 4 blue balls, 4 green balls and 3yellow balls. Two balls are drawn from the bag without replacing the ballafter the first draw.(a)(2 points)Specify the sample space (set of outcomes) and probability distributionof the outcomes.(b)(3 points)If you draw two balls from the bag without replacing them, what isthe probability of drawing two red balls

Answers

Answer:

3 / 91

Step-by-step explanation:

Given :

Red balls = 3

Blue balls = 4

Green balls = 4

Yellow balls = 3

Total number of balls = (3+4+4+3) = 14

Sample space :

RR, BB, GG, YY, RB, BR, BG, GB, YG, GY, YR, RY, BY, YB, GR, RG

Probability of drawing two red balls without replacement :

1st draw :

P(red) = number of red balls / total number of balls

P(red) = 3/14

2nd draw :

P(red) = 2 / 13

Hence,

P(RR) = 3/14 * 2/13 = 6 / 182 = 3 / 91

Find the measurement of the numbered angles

Answers

Answer:

m<1 = 60

m<2 = 30

m<3 = 80

Step-by-step explanation:

1. Solve for angle (1)

The sum of angles in any triangle is (180) degrees. As one can see, there is a (30) degree angle in this triangle, and a (90) degree angle. Bear in mind that the box around an angle indicates that it is a (90) degree angle. One can form an equation and solve for the unknown angle using this given information;

(30) + (m<1) + (90) = 180

Simplify,

120 + m<1 = 180

Inverse operations,

m<1 = 60

2. Solve for angle (2)

The vertical angles theorem states that when two lines intersect, the angles opposite each other are congruent. One can apply this theorem here by stating the following,

m<2 = 30

Thus one gets their answer, the measure of angle (2) must be (30) degrees by the vertical angles theorem.

3. Solve for angle (3)

As states above, the sum of angles in a triangle is (180) degrees. Since one has found the measure of angle (2), one can form an equation and solve for the measure of angle (3) using the given information, combined with the information found.

(m<2) + (70) + (m<3) = 180

Susbtitute,

30 + 70 + (m<3) = 180

Simplify,

100 + m<3 = 180

Invers eoperations,

m<3 = 80

Butternut is a ski resort in Massachusetts. One of their triple chair lifts unloads 5583 skiers per hour at the top of the slope. (A triple chair lift can carry three passengers per chair.) The ride from the bottom to the top takes 5 minutes. How many skiers are riding on the lift at any one time

Answers

Answer:

465.25 skiers at any one time.

Step-by-step explanation:

Given that:

Number of skiers unloaded per hour = 5583

Time taken to move from bottom to top = 5 minutes ;

Number of travels(rides) per hour :

1 hour / 5 minutes = 60 minutes / 5 minutes = 12 rides

If equal number of riders are conveyed per ride ; the Number of riders at any one time is :

Total number of riders conveyed at any one time = 5583 / 12

= 465.25 skiers per trip

Russell deposited $200 to open a new bank account before he paid $250 for his portion of the rent. His bank charged him a $50 overdraft fee. Then he deposited his paycheck of $400. How much money is in Russell’s account now?

Answers

300 dollars I think is it multiple choice

The answers isssssssss

$300

:)

find the mesure of angle b

Answers

Answer:

It's C

Step-by-step explanation:

because there is a 90 degrees sigh behind it and those two angles need to add up to 90

Answer:

31

Step-by-step explanation:

b+59=90

b=90-59

b=31

hope it helps

Other Questions
Joelle is a manager at a construction company, and she is interested in the chemistry behind the materials they use. She has begun studying the materials used to fill walls. She knows that to keep the temperature inside a room steady the material must be a thermal insulator, and she predicts that materials should not be acidic or else they would dissolve too easily in water.Which of these is a molecular ingredient that could be used in a wall-filling material ?C27H36N2O10Na6Ba6NeNaHCl Please help me with this I need it bad Which line from "I'm Nobody! Who Are You? by Emily Dickinson contains a sime?"Then there's a pair of usdon't tell"They d banish us you know.""How public. like a frogTo tell your name the livelong day" In young Goodmans Brown hawthornes reveals his feelings about his Puritan ancestors when Which is the definition of chronology? In what ways were the ideals of the Fourteen Points honored and ignored? Please help, only a couple of days left!!! Translate and solve: twenty-three greater than b is at least 276. Solve the inequality.1x+5 < 62Help me please Please help! I dont understand how to solve it with no angle Which brought an end to the great West African empires?A)an increase in countries producing their own goods and not needing to tradeB)the arrival of Christianity and the decline of IslamC)enemy nations using sophisticated warfare to overpower the outdated tactics of the empireD)emperors being unable to further the development of technology and learning Qu funcin cumple la poltica en los conflictos sociales Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read 1.Name the canan that connects the Red sea to the Mediterranean Sea2.Name the country where coffee was discovered3.Name the system of racial segregation seen in South Africa4What is the term given to the peninsula that forms the easternmost projection of the African continent5Name the precious gem that is the major natural resource of Africa6Name the Savannah region that is the site of the largest mammal migration on Earth A digital signal differs from an analog signal because it a.consists of a current that changes smoothly. b. consists of a current that changes in pulses. c.carries information. d. is used in electronic devices. Write an equation for the line that is parallel to the given line and that passes through the given point. y = 1/2x - 8; (-6, -17). Find the equation of the line that passes through the points A (2, 3) and B (5, -7) how did advancements in technologry help bring a quick end to conflict in the pacific during world war II My School in vanacola In what way was the Third Reich most successful?Strikes only occasionally affected production of goods.Factories and the infrastructure were expanded.The media enthusiastically supported the work of the ruling party.The workplace was open to many individuals.