this is the second part to my last post <--

This Is The Second Part To My Last Post &lt;--
This Is The Second Part To My Last Post &lt;--
This Is The Second Part To My Last Post &lt;--

Answers

Answer 1

Answer:

i dont knwo

Explanation:

i typed i dont knwo'


Related Questions

Europeans dominated other lands. What effect did this have on the citizens of those European countries ?

Answers

Cultures shifted to more European backgrounds, and languages were taught that they would not have otherwise known (A lot of African countries speak French, for example).

Answer:

I think these people had to withstand European disease, and nearly half of their population died because of smallpox, influenza, measles, and chicken pox. A good effect might have been that these people learned how to use European weapons ( like guns) which helped them better hunt and protect themselves. Nutrition was also changed because of the European dominance .

Explanation:. The conquest brought more different foods into the lives of the natives, which made them a bit healthier and able to live longer.

Why did the mongols want to expand their territory?
2 sentence long answer pls

Answers

Answer:

The Mongols wanted to expand their territory because of Trade Disruptions. They were incapable to get products that they so frantically required, the Mongols' reaction was to start attacks, assaults, and at last intrusions against these two dynasties.

Please tell me if I am wrong

May I please have brainliest? c:

The __________________ was settled when T. Roosevelt got involved in the negotiations.

Answers

The legislation was settled when T. Roosevelt got involved in the negations.

Plzzz answer aspppp What effect did the 13 Amendment
have on the ECONOMY?

Answers

Please don't just copy my answer :) Please just use it as inspiration for your own response.

     The 13th amendment not only banned slavery, but had a lot to do, with the economy. There have been many job opportunities that became available due to slave shortages.Any farmer who was unable to afford paying employees had to sell any or all of their land. There were many jobs available, but none were openly available to African Americans. African Americans began finding employment very difficult due to the southern hate for their race.

Hope this helps! Please correct me if I'm wrong :)

What city is at 50°N, 70°E

Answers

Answer


It’s a land

I think
Cologne, Germany :))(


Despite Hitler's aggression in Europe, the United States continued to pursue a policy of
O isolationism.
O appeasement
Oblitzkrieg
O mobilization.

Answers

Answer:

A. isolationism.

Explanation:

We tried to stay out of the war until Pearl Harbor was bombed

Answer:

Isolationism

Explanation:

I got it right on Edge and the other options are completely wrong.

The US did not appease Europe or Germany when other countries allowed Germany to reclaim some land in a pursuit to stop Germany's aggression.

Blitzkrieg is German for "lightning war" which is a military strategy they used to take countries like Poland

At this time the US had not entered the war so mobilization is therefore wrong.

What is a plateau?
A. dense evergreen forest with abundant rainfall
B. large raised area of mostly level land
C. strip of land with water on both sides that joins two larger bodies of land
D. large region of flat grasslands that stretches through Argentina and Uruguay

Answers

A plateau is B - a large, raised area of mostly level land. :^)

4)
How were members of the elite class and the middle class ALIKE?
A)
They both owned farms.
B)
They both owned slaves.
C)
They both lived in cities.
D)
They both worked as lawyers.

Answers

The answer is c because they both lived some were in cities
The answer should be C

Which statement best describes why Progressives worked to reform the meat-packing industry in the early 1900s?

Answers

Answer:

I believe its c the induatry used unsafe manufacturing practices. i hope this helps.

Explanation:

I’m pretty sure it’s c but correct me if I’m wrong

Need plez brainly to the person right with reason

Answers

Answer:

your answer is b because I learned this last year

Answer:

im pretty sure its B

Explanation:

“It is for us the living, rather, to be dedicated here to the unfinished work which they who fought here have thus far so nobly advanced. It is rather for us to be here dedicated to the great task remaining before us—that from these honored dead we take increased devotion to that cause for which they gave the last full measure of devotion—that we here highly resolve that these dead shall not have died in vain—that this nation, under God, shall have a new birth of freedom—and that government of the people, by the people, for the people, shall not perish from the earth.”
Abraham Lincoln, Gettysburg Address, November 1863
Which of the following most directly contributed to the conflict referred to in the excerpt?

Answers

Answer:

November 1863

Explanation:

What is the judicial branch made up of?
a. supreme committees
b. a leader that did not have too much control
c. courts
d. a king who listened to everything the people said

Answers

Answer:

A

Explanation:

The judicial branch consists of The Supreme Court.

Answer:

supreme committee’s

Explanation:

judges

Which of the following did the Union and the Confederacy fight for control of in the West?
major cities
the US capital
key rivers
Texas

Answers

the answer is key rivers

Answer:

key rivers

Explanation:

I just did the quiz

which Indian lives where the temperature is below freezing​

Answers

Answer:

"Dras" I think hehe

Explanation:

Risk*

A business must decide whether to open a new office in China. If it opens the
branch, it will increase its chances of selling a high volume of its products in
China. On the other hand, the business will have to spend a lot of money to
make the branch operational
What would be an opportunity cost for the business if it chooses to open the
new branch in China?

Answers

Answer: A. The business would lose the chance to make more money in China.

Explanation:

Here's the complete question:

business must decide whether to open a new office in China. If it opens the

branch, it will increase its chances of selling a high volume of its products in China. On the other hand, the

business will have to spend a lot of money to make the branch operational.

What would be an opportunity cost for the business if it chooses not to open the new branch in China?

A. The business would lose the chance to make more money in China.

B. The business would have to open a new branch in a different country.

C. The business would increase its marginal benefits on each product it makes.

D. The business would be able to use the money it saves on other projects.

Opportunity cost is the cost of an economic entity forgoing a particular thing when another alternative choice is being made by such entity.

For example, in this. case, the opportunity cost of the business would be the money that the business would have made if I had opened the branch in China.

PLease help me answer this !!!

Answers

Answer:

Explanation:

The U.S. prepared for war by first building- up the military in readiness for deployment, by initiating a draft. President Woodrow Wilson sought Congress support in the declaration of war against Germany. ... Businesses and citizens were strongly urged to support the war through government and media communications.

Should the United States fight wars to advance democracy around the world?

Answers

Answer:

no becua

se the pres wouldent have any troops left for the milatary

Explanation:

Answer:

no not at all so yeah it said this needs to be 20 characters long

WILL MARK BRAINLIEST (HOMEWORK TIMED PLEZ HELP)
how did louis' XVI involvement in wars weaken france finacially?

Answers

Answer:

KEY POINTS

Louis XIV began his personal reign with effective fiscal reforms. He chose Jean-Baptiste Colbert as Controller-General of Finances in 1665, and Colbert reduced the national debt through more efficient taxation. However, the gains were insufficient to support Louis’s policies. During his reign, France fought three major wars and two lesser conflicts. In order to weaken the power of the nobility, Louis attached nobles to his court at Versailles. These strategies to hold centralized power, although effective, were very costly.

To support the reorganized and enlarged army, the panoply of Versailles, and the growing civil administration, the king needed more money. Only towards the close of his reign under extreme stress of war was he able to impose direct taxes on the aristocratic population. However, so many concessions and exemptions were won by nobles and bourgeois that the reform lost much of its value.

Louis encouraged industry, fostered trade and commerce, and sponsored the founding of an overseas empire, but the powerful position of Louis XIV’s France came at a financial cost that could not be balanced by his reforms. The considerable foreign, military, and domestic expenditure impoverished and bankrupted France.

Cardinal Fleury was Louis XV’s chief minister and his rule was the most peaceful and prosperous period of the reign of Louis XV. After the financial and social disruptions suffered at the end of the reign of Louis XIV, the rule of Fleury is seen by historians as a period of “recovery.” Following Fleury’s death, Louis failed to continue his policies.

Louis XV attempted fiscal reforms that included the taxation of the nobility but his foreign policy failures weakened France and further strained its finances. As a result of lost wars, Louis was forced to cede many territories, including lucrative overseas colonies.

Lost wars and subsequent financial strains, ineffective reforms, and religious feuds, combined with XV’s reputation as a man interested more in women and hunting than in ruling France, weakened the monarchy that was left in a state of economic crisis.

Explanation: brainliest please

2. Compare and contrast social policy with economic policy. What are some examples
of each policy? How might each type of policy address the same problem in a different
way? (5 points)

Answers

Answer:

Well, the social policy is very communist while the economic policy is very socialist. They would address the same problems in many different ways such as a food shortage, the social policy would want to spread more welfare while the economic policy would want to spread more capitalism.

Explanation:

I am a college major in history it is fine if you copy and paste, I wrote this myself!!

Mark me brainliest!!!

Which geographic region is not included in Latin America?
A. North America
B. South America
C. Central America
D. Caribbean islands

Answers

The answer is C. Have a god blessed day.
D the Caribbean Islands

Select the correct answer from each drop-down menu.
Complete the following paragraph about the development of the study of geography.

Answers

in my thought I think this is my answer in explanation

Explanation:

Geography was first systematically studied by the ancient Greeks, who also developed a philosophy of geography; Thales of Miletus, Herodotus, Eratosthenes, Aristotle, Strabo, and Ptolemy made major contributions to geography. The Roman contribution to geography was in the exploration and mapping of previously unknown lands. Greek geographic learning was maintained and enhanced by the Arabs during the Middle Ages. Arab geographers, among whom Idrisi, Ibn Battutah, and Ibn Khaldun are prominent, traveled extensively for the purpose of increasing their knowledge of the world. The journeys of Marco Polo in the latter part of the Middle Ages began the revival of geographic interest outside the Muslim world.

The
protected the Egyptians from invasion.
Mediterranean Sea
Euphrates River
Tigris River
Nile River
Red Sea

Answers

Answer:

My answers is Mediterranean Sea.

Explanation:

If I need to choose only one answer it would be Mediterranean sea, as it was to the north to Egypt, which meant that it was impossible to attack Egypt from North without navy.

Red Sea can be also the correct answer as it protects Egypt from the east, although Sinai Peninsula connects Egypt with Asia.

Tigris and Euphrates are in Mesopotamia, not Egypt.

Nile is not correct as the river flows across Egypt and couldn't prevent invasion.

Why was the New Deal initiated? What problems did it address? What were some possible unintended consequences of the New Deal? Did the New Deal solve the problems it was designed to solve? Do you believe the legacy of the New Deal is a positive or negative? Explain.

Answers

Answer:

Explanation:

1) The New Deal was initiated as a way to help America escape the Great Depression. This new set of federal laws and agencies, created by Franklin D. Roosevelt, was meant to:

--help the American economy recover.

-- provide immediate economic relief to those who need it.

--reform certain industries (like the banking industry) to ensure that this type of economic collapse does not happena again.

2)This New Deal addressed problems with the stock market, American economy, and the banking industry. Roosevelt developed federal agencies like the Securities and Exchange Comission to oversee the stock market and he enacted laws such as the bank holiday to help banks re-establish themselves with paper currency.

3) One unintended consequence of the New Deal was that American citizens became more reliant on the federal government to provide resources/support during hard economic times. Before this New Deal, there were very few instances of the federal government getting directly involved in the economy in order to help citizens.

Mussolini took many steps to impose order in Italy. Which of the following steps did
he avoid?
A. Limiting free speech
B. Glorifying the military to rally followers
C. Abandoning the parliamentary system
D.increasing the parliamentary system

Answers

The correct answer is C. Abandoning the parliamentary system

Explanation

Benito Mussolini (1883-1945) was an Italian dictator politician, who ruled Italy between 1922 and 1945 as leader of the Republican Fascist Party with which he established his totalitarian regime during the period known as Italian fascism, under the approval of King Victor Emmanuel III, until its collapse in World War II. The government of him being totalitarian was characterized by his absolute and unrestricted exercise of power. Furthermore, he severely restricted individual freedoms and built a homogeneous, ruthless, and coercive model of society. Also, he left the parliamentary system to impose his dictatorial system in Italy, therefore, the correct answer is C. Leave the parliamentary system.

Answer:

He glorified the military to rally followers

Explanation:

i just took the quiz!!!! 100% the right answer

Who was the women who won her freedom by saying that all men are
created equal?*

O Sojourner Truth

O Betty Davis

O Mum Bett

O Crispus Attucks

Answers

Answer:

benjamin franklin and wanna see my pokemon cards

Explanation:

What was the outcome of the Mexican Revolution?
A. Mexico formed a military dictatorship.
B. Mexico formed a socialist democracy.
C. Mexico formed a fascist dictatorship.
D. Mexico formed a constitutional republic.

Answers

Answer:

D. Mexico formed a constitutional republic.

Explanation:

the pf text book states:

"Ultimately, the Mexican Revolution was successful in creating a constitutional republic."

hope this helps!!

The result of the Mexican Revolution was the formation of Mexico into a constitutional republic.

Option D is the correct answer.

What was the Mexican Revolution?

Mexican Revolution was started in the year 1910 and ended in the year 1920. It was the regional fights by the people of Mexico for ending up the dictatorship rule of Diaz.

After Mexican Revolution, the state of Mexico becomes a constitutional republic which means a state where there is an election held for appointing the chief executive members and the representatives of the state. The rules and regulations for holding elections are written in the constitution of the country.

Therefore, Mexico emerged as a constitutional republic after the Mexican Revolution.

Learn more about the Mexican Revolution in the related link:

https://brainly.com/question/14304703

#SPJ2

15. In a speech to Congress in April of 1917, President Woodrow Wilson explained his decision to abandon
neutrality in World War I on the grounds that
A. The human rights abuses carried out by the German government must be punished.
B. The United States was on the brink of a depression and war would revitalize the economy.
C. Only by entering the war would the United States be able to make the world safe for democracy.
D. The United States must enter the war in order to protect its overseas territories from German
aggression.

Answers

Answer:

undefined or not so much as a good thing for the element has to come from a cm lon that is 8 to say something about it 3 in ethiopia and the

what symbols of westward expansion do you see in the painting​

Answers

There’s no painting or image..

Answer:

To Jefferson, westward expansion was the key to the nation's health: He believed that a republic depended on an independent, virtuous citizenry for its survival, and that independence and virtue went hand in hand with land ownership, especially the ownership of small farms

Explanation:

Calligraphy _________________

Answers

Calligraphy is a type of handwriting.

Answer:

A

Explanation:

Match each idea with the correct candidate. Supported taxes on goods brought into the country Believed in the rights of the common man Opposed slavery

Answers

The ideas of Supported taxes on goods brought into the country, believed in the civil rights of the common man, and Opposed slavery of Adams, Jackson, and Adams respectively.

What are civil rights?

The Latin phrase "ius civis," which translates to "rights of a citizen," is where the word "civil rights" originates. Everyone who is regarded as a citizen of a nation should be given equal protection under the law. There have been numerous civil rights movements throughout history.

A class of rights known as civil and political rights guards against the violation of peoples people's freedom by the government, other social institutions, and private parties. Civil rights guarantee that one is entitled to take part in society's and the government's civic and political life without persecution or prejudice.

The U.S. Constitution and federal legislation passed by Congress, such as the Civil Rights Act of 1964 and the Americans with Disabilities Act of 1990.

Thus, it provides and safeguards civil rights, which are individual freedoms. Legal discrimination is protected by civil rights.

Learn more about Civil Rights:

https://brainly.com/question/1142564

#SPJ2

Other Questions
Take notes about this passage and identify the key words.The Declaration of Independence is a document that was signed by a group ofpeople in the New World who decided to split off from the King of England. Theywanted to become an independent country. These leaders wanted other peopleto respect them, and so the declaration was their explanation of why they weresplitting off from England. They believed: That all men are created equal That all men have some rights given to them by God That among these rights are life, liberty, and the pursuit of happiness.Among the men who signed this declaration of independence were BenjaminFranklin and Thomas Jefferson. WILL AWARD BRAINLIESTDescribe how Romeos mood changes over the course of Act One. Use details from the text to justify how he was at the beginning of Act One, and how he feels at the end. What is the cause for this change? Is (1, -7) a solution of y=x-8?Yes Please help me with these questions FAST it's formal and I can't faillllllll!!!!!!, If you had to define ecological succession in your own words in a 140 character text, how would you define it? Dominique's age is 4 years less than twice brother's age b. Dominique is 12 years old. How old is her brother? Write an equation and solve using the replacement set of (6,7,8) How do I know whether this is a function or not? And can someone EXPLAIN the steps on how to determine on how it would be a function please? pleaseeeeeee helpppppppppp Do a Hybrid CrossFill out the Punnett Square below for this story:Mary has blue eyes (bb) and David has brown eyes (Bb), if David and Mary have four children what will their eye color be? Will all their children have the same eye color? Why or why not.Child 1: Child 2:Child 3: Child 4: Thirteen more than three times a number is 25. A mass of 630g is hung on a spring. Using Force = mass x gravity, what is the force of the mass, acting on the spring? What can you infer about the schools educational and social goals, based on Doves experiences? Someone help me match the last two to their definition Hypotonic and Isotonic help would be appreciated ** if you could explain thatd be cool but if not thats ok 0.47 100with process Mircale are u online right now I need to talk to you pls Help me please Im begging u 3) What type of government did the Aztecs have? *A.One kingB. Prime MinisterC.PriestsD. Decentralized government made up of city states, each with their own kingsqueens what is 1256x - 14x + 16x simplified Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) list the difference between sdram and dram