trigonometry please help! work need to be shown

Trigonometry Please Help! Work Need To Be Shown

Answers

Answer 1

Answer:

6.13

Step-by-step explanation:

This diagram shown is a right triangle;

USing the SOH CAH TOA idenity

Adjacent = x

Hypotenuse = 8

Angle of elevation = 40 degrees

cos theta = adj/hyp

cos 40 = x/8

x = 8cos40

x = 6.13

Hence the value of x to the nearest hundredth is 6.13


Related Questions

2y + 4 - xy - y + x² + 6y - 3x²=

Answers

Answer:

7y-2x^2+4+xy

Step-by-step explanation:

Identify the center and radius of the circle with the following equation: [tex]x^2+y^2+4x+8y+11=0[/tex]

Answers

Hey there,

Put the equation into the circle equation [ (x - h)² + (y - k)² = r² ].

x² + y² + 4x + 8y = -11

(x² + 4x) + (y² + 8y) = -11

(x + 2)² + (y + 4)² = 9

If that is confusing, you can always rewrite it to show exactly what you need in the circle equation.

(x - (-2))² + (y - (-4))² = 3²

Therefore, using the circle equation we can see that the center is at the point (-2, -4) and the radius is 3.

Best of Luck!

Answer:

[tex] \displaystyle \text{centre} :( - 2, - 4)[/tex]

[tex] \text{redius} : 3[/tex]

Step-by-step explanation:

we are given a circle equation

[tex] \rm \displaystyle {x}^{2} + {y}^{2} + 4x + 8y + 11 = 0[/tex]

we want to figure out the centre and the redious of the circle from the equation notice that the given circle equation is in general form given by

[tex] \rm \displaystyle {x}^{2} + {y}^{2} +A x +B y +C = 0[/tex]

general form of circle equation is a simplified version of standard form. the standard form of circle equation is given by:

[tex] \displaystyle (x - h {)}^{2} + (x - k {)}^{2} = {r}^{2} [/tex]

where:

(h,k) is the centrer is the redious

notice that the there're two completed squares in the standard form therefore we can consider completing square to figure out the centre and the redious

indentifying centre and redious:

rearrange:

[tex] \rm \displaystyle ( {x}^{2} + 4x ) +( {y}^{2} + 8y) + 11 = 0[/tex]

cancel 11 from both sides:

[tex] \rm \displaystyle ( {x}^{2} + 4x ) +( {y}^{2} + 8y) = - 11[/tex]

add 4 to the both sides so that the equality don't affect:

[tex] \rm \displaystyle ( {x}^{2} + 4x + 4) +( {y}^{2} + 8y) = -11 + 4[/tex]

simplify addition:

[tex] \rm \displaystyle ( {x}^{2} + 4x + 4) +( {y}^{2} + 8y) = - 7[/tex]

once again to complete the square add 16 to both sides which yields:

[tex] \rm \displaystyle ( {x}^{2} + 4x + 4) +( {y}^{2} + 8y + 16) = 9[/tex]

complete the squares by using (a+b)²=a²+2ab+b² pattern:

[tex] \rm \displaystyle ( {x}+ 2) ^{2} +( {y} + 4) ^{2} = 9[/tex]

we can still rewrite it to figure out the redious and the centre:

[tex] \rm \displaystyle ( {x} - ( - 2)) ^{2} +( {y} -( - 4) ) ^{2} = {3}^{2} [/tex]

therefore we obtain:

centre:(h,k)=(-2,-4)redious:r=3

and we are done!

Based on a sample survey, a tutoring company claims
that 90% of their students pass their classes. Out of 300 students, how
many would you predict will pass?

Answers

Answer:

270

multiply the number by the percentage-

300 x .90= 270 students

Answer:
Out of the 300, I predict 270 will pass.

Explanation:
You just have to multiply 90% by 300 and you’ll get 270.

Mr. Johnson sells erasers for $3 each. He sold 96 erasers last week
and he sold 204 erasers this week.

Answers

Answer:

$900

Step-by-step explanation:

He makes $288 the first week and $612 the second week the total amount of money he makes is $900

Answer:

96*3= $288 from last week

204*3= $612 from this week

The total is $900 from both weeks

Step-by-step explanation:

Hope this is what you were asking!

Which is the graph of x2/9-y2/4=1

Answers

Answer:

Step-by-step explanation:

Elyssa bought a rectangular aquarium . The measurements , in feet (ft) , are shown below. How much water will it take to fill the aquarium?

Answers

Answer: The answer is 34 13/20.

Step-by-step explanation:

I did it and was correct for me! Hope it helps ❤️

Answer:

34 13/20

Step-by-step explanation:

Help plz so I don't get phone taken

Answers

1) d/r = t

2) P/3 = s

3) 8.2cm

4) C/2pi = r

5) P/3r = q

someone help me pls ‍♀️

Answers

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

Answer: 7 anchors and 2 floats

I hope this helped!

<!> Brainliest is appreciated! <!>

- Zack Slocum

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

HELP PLEASE HELP I WILL MARK BRAINLEST 3. Elena types approximately 50 words per
minute. How many minutes will it take her to
type an essay with a maximum of 800 words?
Inequality
Solution

Answers

Answer:

if she types 50 words per minute it would be 16 minutes for her to get to 800 words

Step-by-step explanation:

Answer:

16 minutes

Step-by-step explanation:

800 divided by 50 = 16

A deep sea diver started at sea level (0 feet) and dove at a rate of 5.6 feet per minute. If the diver dove for ½ hour, what rational number represents his position relative to sea level? Show your work. A. 168 feet B. 2.8 feet C. -2.8 feet D. -168 feet

Answers

Given:

A deep sea diver started at sea level (0 feet).

Rate of diving = 5.6 feet per minute.

Time = [tex]\dfrac{1}{2}[/tex] hour

To find:

The rational number that represents his position relative to sea level.

Solution:

We know that,

1 hour = 60 minutes

[tex]\dfrac{1}{2}[/tex] hour = 30 minutes

A deep sea diver, dove at a rate of 5.6 feet per minute.

Distance covered in 1 minute = 5.6 feet

Distance covered in 30 minute = 30 × 5.6 feet

                                                    = 168 feet

The diver dove 168 feet in [tex]\dfrac{1}{2}[/tex] hour. Since it is below the sea level, therefore it should be negative.

So, the rational number that represents his position relative to sea level is [tex]-168[/tex] feet.

Therefore, the correct option is D.

x²-x-2=(x-2)
its quadratic equation
please guys help meee
i dont know how to solve it​

Answers

Answer:

x= (2,0)

hope it helps!!

What is the surface area of a cone with a radius of 6 meters and a slant height of 8 meters? Round to the nearest tenth. *
10 points
263.8 m2
904.0 m2
452.0 m2
1,055.2 m2

Answers

Answer: 263.8m2

Step-by-step explanation:

Formula: S.A=Pi x radius2 + Pi x radius x slant height


If the hypotenuse of a right triangle is 8 and one leg is 6, what is the length of the other leg?

Answers

Answer:

5.3

Step-by-step explanation:

pythagorean theory :,)

[tex]a^{2} + b^{2} = c^{2}[/tex]

the legs are [tex]a[/tex] and [tex]b[/tex], while the hypotenuse (the longest side) is [tex]c[/tex]

fill in the equation with the information u have and simplify so

[tex]a^{2} + 6^{2} = 8^{2}[/tex]

[tex]a^{2} + 36 = 64[/tex]

now get the variable ([tex]a[/tex]) by itself

[tex]a^{2} + 36 = 64\\[/tex]

(subtract 36 on both sides)

[tex]a^{2} = 28[/tex]

[tex]a = 5.3[/tex]

square root of both sides ≈ 5.3

(you could also multiply the square root of 7 by 2)

Write the equation of the circle with a center at (11,6) and a radius of 6.

Answers

Answer:

(x-11)^2 + (y-6)^2= 6^2

Step-by-step explanation:

Answer:

(x - 11)² + (y - 6)² = 36

Step-by-step explanation:

The equation of a circle in standard form is

(x - h)² + (y - k)² = r²

where (h, k) are the coordinates of the centre and r is the radius

Here (h, k ) = (11, 6 ) and r = 6, then

(x - 11)² + (y - 6)² = 6² , that is

(x - 11)² + (y - 6)² = 36

Problem
3. The diagram shows the distance a tortoise can
walk if it walks at a constant pace for 15
minutes. At the same rate, how many
kilometers can the tortoise walk in 1 hour?
Write your answer as a decimal.
Minutes H
0
15
Meters
+
400
0

Answers

Explanation is in the file

tinyurl.com/wpazsebu

find the area of each parelogram

Answers

Answer:

A. 8

B. 10

C. 8

Step-by-step explanation:

If this helped brainliest would be appreciated!

Anyone knows geometry???
The answer choices are
A: 2 and 8
B: 1 and 4
C: 6 and 7
D: 5 and 8

Answers

Answer:

Option: A

Step-by-step explanation:

Hope it helps you!

NEED HELP ASAP FREE BRAINLIST

Answers

Answer:

13.6

Step-by-step explanation:

[tex]a^2+b^2=c^2\\4^2+13^2=c^2\\16+169=c^2\\c^2=185\\\sqrt{c^2} =\sqrt{185} \\c=13.6[/tex]

The table shows the amount of money each person has or owes. A negative
number means that the person owes money.
Name
Alma
Fazil
Rachel
Justin
Amount ($)
-35.00
30.00
-8.25
6.50
Tell whether each statement is True or False.
a. Rachel has more money than Justin.
b. Fazil has more money than Alma.
True False
True False
True False
True False
C. Justin has less money than Fazil.
d. Alma owes less money than Rachel.

Answers

Answer:

false

true

true

false

.......

Write the exponential expression
26 squared

Answers

Answer:

26²

Step-by-step explanation:

26 x 26 = 676

NEED HELP ASAP|!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

thanks for freepoints

have q nice dayyyyy

love youuuuuuuuuu

hope all your dreams come true

hahahahahahahahahah

Data that's displayed randomly on a scatter plot graph illustrates (please help asap!)

positive correlation.

negative correlation.

none of these.

no correlation.

Answers

D. No Correlation, since it is randomly being placed around a graph this is no negative or positive, which results it into being no correlation

The height of a square pyramid is 15 centimeters. The sides of its base measures 6 centimeters. What is the volume of the pyramid?

Answers

Answer:

180cm^3

Step-by-step explanation:

Given data

Height b=15 cm

Base a= 6cm

The expression for the volume of a pyramid is

V=a^2h/3

Substitute

V= 6^2*15/3

V= 36*5

V=180cm^3

Hence the volume is  180cm^3

please help me with the question​

Answers

Answer:

x = 12

Step-by-step explanation:

Given a tangent and a secant from an external point to the circle.

Then the product of the external part of the secant and the entire secant is equal to the square of the measure of the tangent, that is

3x = 6² = 36 ( divide both sides by 3 )

x = 12

a stadium shaped like a hemisphere with a radius of 150 feet. last month the owners of the stadium paid $0.05 per cubic foot to cover the cost of utilities. what was the total cost for utilities last month​

Answers

The formula for volume of a hemisphere is: V = 2/3 * π * r³

Volume = 2/3 x 3.14 x 150^3

Volume = 7,065,000 cubic feet.

Multiply the cost per cubic foot by the volume:

7,065,000 x 0.05 = 353,250

The total cost was $353,250

How do you write 3x to the -5 power using only positive exponents?

Answers

Negative:

(3x)^-5

Positive:

(1/3x)^5



A researcher is interested in the effect of alcohol consumption on reaction times. Participants are assigned to one of three possible conditions: nonalcoholic beer group, 1 beer group, 2 beer group. After drinking, each participant is run through a driving simulator that measures their reaction time to unexpected obstacles (e.g., a child running into the street after a ball) that randomly appear during the simulation. In this example, what is the independent variable

Answers

Answer:

The three different possible conditions ;

nonalcoholic beer group, 1 beer group, 2 beer group

Step-by-step explanation:

The Independent variable, also known as the predictor variable are variables used to influence and check changes in the dependent or predicted variable as subjects are exposed to the different types or levels of independent variable used in the study.

In the scenario described above, the predictor or independent variables which are used to measure the reaction times of participants to unexpected variables is the independent variable, beacuse these different variables ; nonalcoholic beer, 2 beer will probably affect the response time of the participants which is the dependent variable.

pleae answer this fast asap

Answers

Answer:

I think its (2, 1) .

Step-by-step explanation:

the 2 represents the x axis

the 1 represents the y axis

2(x + 10) = 26
Solve for x

Answers

Answer:

3

Step-by-step explanation:

help with this question please

Answers

x is less than 5.
Because the circle is not closed, there’s no equal to.
Because it’s going to the left, it’s less.

Answer:

A; x< 5

Step-by-step explanation:

A simple way to remember the difference between greater than or less than is picturing the symbol as an alligator, the mouth of the alligator, the open end, eats the bigger number. The line under the greater than/ less than symbol means "or equal to". An open circle on a number line means that it's NOT "or equal to", so the answer isn't B or D. On the number line, it shows what x could equal. The arrow falls on 0, I'll use 0 as an example. Is 0 less than 5? Yes. If x could equal 0, that means that x is less than 5.

Other Questions
Why has the South traditionally been the poorest region of the US? Which to expressions are equivalent to 3.2 (4p + 8.5)?3.2 (Ap) + 3.2(8.5)7.2p+8.512.8p+ 27.215.7p40p I needddd helpppppppppppooopp urgentttttt will mark brainliest In his free time, Gary spends 11 hours per week on the Internet and 8 hours per week playing video games. If Gary has five hours of free time per day, approximately what percent of his free time is spent on the Internet and playing video games? In a family with parents who do not have hemophilia, one son has hemophilia. Who was the carrier of the gene for hemophilia?*if possible, I also need a Punnett square * __C+_SO2_CS2 + __CO Which ecosystem would be affected the most by losing its butterflies, and why? A. Ecosystem 2 because it has more kinds of plants, animals, and insects. B. Ecosystem 1 because it has more plants that depend on the butterfly. C. Ecosystem 2 because it has more insects that compete with the butterfly. D. Ecosystem 1 because it has fewer kinds of plants, animals, and insects. 15% of 20 is ??? please helpp What is the distance between (3,7) and (-3,-1) ? In the late1890s, who created a support system to help African American businesses? Jim Crow Pat McCrory W.C. Coleman A.M. Waddell Please Help ASAP before midnight. Write a unit rate for the situation.$12.50 for 5 ouncesAlso if you can, with your answer can you tell me how to find unit rate? A pyramid with an equilateral-triangle base has a volume of 48sqrt{3} cm3 and a height of 16 cm. Find the length of each side of the equilateral triangle.You get brainliest, i need answers fast. How was religion in ancient Rome similar to religion in ancient Greece? (Choose 3)ARoman gods had the same names.BRoman gods had human-like qualities.CRoman religion was polytheistic.DRoman gods were different aspects of one God.ERoman religion included a holiday called Saturnalia.FRoman gods played an important role in everyday life by protecting families, homes, farms and even animals. Rewrite the number in Standard form6 x 10^8 What is the main source of winds and weather? A. The spinning EarthB. The Earth's rotation on its axisC. The layers of the planetD. The sunI will mark correct answer brainliest 3+4-8+9-8+78+99-7999+8799+06997+90797883+677_5= 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA Help please! 50 points! Troll answers WILL be reported Describe how each of thefollowing are evidence for Continental Drift1. Fossils2. Landforms3. Rock Formations4. Climate what is 3/4x2/3a.5/12b. 6/12c.5/7d. 6/7