Answer:
[tex]f=5*10^1^4kg/year[/tex]
Explanation:
[tex]T=m/f\\f=m/T\\f=\frac{3*10^1^5kg}{6 years}[/tex]
The mass flow rate of CO2 into and out of the atmosphere is [tex]f = 5 * 10^{14} kg/ year[/tex]
What is the method ?
[tex]T = m/f[/tex]
Therefore, [tex]f = m/ t[/tex]
[tex]f=3 * 10^{15} / 6 years[/tex]
So, the correct answer is : [tex]f = 5 * 10^{14} kg/ year[/tex]
What is mass flow rate?
The mass of a substance which passes per unit of time.Its unit is kilogram per second in SI units, and slug per second or pound per second in US customary unitsLearn more about mass flow rate below,
https://brainly.com/question/15877818
#SPJ2
Should we clone animals that are going or have gone extinct (in other words bring them back
either from the brink of extinction or from extinction)? Explain your answer.
Answer:
I think we should but people are preventing this though
Explanation:
I think we should because it might benefit the world and let scientists to discover this animal. But then I don't think so because animals that are/were extinct could perhaps be from climate change. Nowadays, people don't take this matter seriously causing habitats to be destroyed and animals to be extinct :) Like icebergs are melting that mean penguins are at risk of being extinct,if we did something then this situation will be prevented. However dinosaurs did become extinct and they did not come back so its probably just life and this is how god planned it:)
do you think there is the roots in utricularia?
Answer:
I think so
Explanation:
Select all the correct answers.
The Alps mountain range lies near the boundary of the Eurasian Plate and the African Plate. These mountains are thought to
be the result of two continental plates colliding. Which of these statements would provide evidence for this theory?
Answer:
it would reason that the first sentence is the most evidentiary, since it is fact based verses the second sentence which is theory.
Answer: The mountains are continuously increasing in size. and Periodic earthquakes occur in the region.
Explanation: i literally got my question wrong because i listened to that other guy and he was completely wrong. dont make my mistake and listen to silly people.
In the diagram below, which part of the human brain coordinates balance, movement, and other muscle functions so that the body moves smoothly? A B C
Answer:
c
Explanation:
c is the cerebellum
b is the spinal chord
a is parietal lobe
The species Trichonympha ______________. Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a may be isolated from the gut of termites where it is essential for cellulose digestion b is a ciliated organism c is a flagellated organism d both a and b e both a and c
Write an experiment to show that sunlight is necessary for photosynthesis.
Answer:
Explanationwe have two or three plants, they both get the same water every day they both get the same amount of soil and fertilizer, one is without sunlight and one is with, after a 2 weeks our results will be found
hope this helps
which structures are found in typical prokaryotic cells and also in typical plant cells
a) cell walls
b) histones
c) telomeres
d) tonoplasts
Answer:
a. cell wall
pls Mark brainliest
The only Purple Animal is the South African____?
Answer:
Okapi
Mark Brainliest
okapi...
hopr helps uh
..yhnk my ansr
Which of the following are structures of the
lymphatic system? Check all that apply.
Heart
Bone Marrow
Thymus
Spleen
Blood Vessels
Tonsils
Adenoids
Answer:Bone Marrow
Thymus
Spleen
Explanation:Bone Marrow
Thymus
Spleen
The following are structures of the lymphatic system -
Bone MarrowThymusSpleenTonsilsAdenoidsThe lymphatic systemis a network of tissues, vessels, and organs.these structures work together to move a colorless, watery fluid called lymph back into your circulatory system (your bloodstream).The lymphatic system has the following structures:lymph nodes,spleen,thymus the lymphatic tissue found in the small intestine (Peyer's patches)adenoid tonsils,palatinetubal tonsilsThus, the following are structures of the lymphatic system -
Bone MarrowThymusSpleenTonsilsAdenoidsLearn more:
https://brainly.com/question/16074605
You want to study the effect of agriculture run-off on the rate of antibiotic resistant bacteria in ponds. You gather samples from ponds surrounded by high density livestock areas and from ponds at least ten miles from agriculture activities. You grow the bacteria on plates and test how resistant they are to antibiotics. Based on this experiment, the proximity of the pond to agriculture would be best categorized as what
Complete question:
You want to study the effect of agriculture run-off on the rate of antibiotic-resistant bacteria in ponds. You gather samples from ponds surrounded by high-density livestock areas and from ponds at least ten miles from agriculture activities. You grow the bacteria on plates and test how resistant they are to antibiotics. Based on this experiment, the proximity of the pond to agriculture would be best categorized as what?
the control group the independent variable the dependent variable the hypothesisAnswer:
2. the independent variable
Explanation:
During an experiment, data from an experimental group is compared with the data from a control group. Both groups are selected from the same pool or population, so they are identical in all aspects except for the independent variables.
The election of a control group is essential in an experiment. Its principal purpose is to allow the discrimination of the results obtained by the treatment in the study, from the results that might be a consequence of other factors. The control group does not receive any treatments. It is used to identify any other factors influencing the results obtained in the study, apart from the modified variables of the treatment.
The experimental group is the one that receives the experimental procedure or treatment. The researcher voluntarily changes the independent variables in the experimental group to observe how they affect the group under study. These variables are kept constant in the control group, not influencing the results, while the experimental group receives the treatment. There can be several experimental groups.
Independent (manipulated) variable: Refers to all the variables in an experiment that provoke a response in another variable. An independent variable is the one that changes or is controlled and modified in the experiment to analyze how another variable responds to it. It changes to analyze its effects on the dependent variable. Usually, the independent variable is represented by the X letter.
Dependent variable: Refers to the variable that depends and reacts to any change in the independent variable. It represents a quantity of something which value depends on how the independent variable is modified. This change might be proportional or inversely proportional to the change in the manipulated variable. It is usually identified by the letter Y.
The hypothesis is a conjecture. The researcher hypothesizes in order to predict what is going on or what is expected to occur. A hypothesis is a claim of how it works a relation between two or more variables. Usually, it is written in the present time.
----------------------------------------------------------------------------------------------------------
The proximity of the pond to agriculture might be considered as an independent variable.
The researcher chooses ponds according to their distance from the crops. In the exposed example, the researcher chose a pond is surrounded by high-density livestock areas and another one at least ten miles away.
The magnitude of run-off might depend on how far the pond is from the crops.
why do males and females have different signs and symptoms when it comes to heart attacks
[tex]{\huge{\underline{\sf{\red{Answer}}}}}[/tex]
For men and women, chest pain or discomfort is the most common heart attack symptom, but women are more likely to report shortness of breath, back or jaw pain, and nausea and vomiting. Black women of any age have a higher incidence of heart attacks than white women.
What is the percent yield of the reaction below if 84.0 grams of Al2O3(s) is recovered from a reaction whose theoretical yield of Al2O3(s) is 104 grams?
4 Al(s) + 3 O2(g) → 2 Al2O3(s)
Answer:
is that 23% ..
.. according to my knowledge
Most streams result from _____.
a. altitude
b. melted snow
c. oceans
d. rivers
Answer:
....b........ melted snow
Why do all proteins given a negative charge prior to electrophoresis?
Answer:
The principle for native gels when Coomassie is not added to the sample is that proteins are separated by a combination of size and charge. The charge in general depends on the number of amino acid residues that bear a positive or negative charge at the pH of the gel. So if running the gel at pH from 8.3 / 8.9, Asp and Glu will be negatively charged, Lys and Arg and His will be protonated and have a positive charge. The N- terminus would have a positive charge while the C terminus would have a negative charge. There might be exceptions depending upon the micro environment of each residue. Native gels can be run at acidic pH as well, to give another way of resolving proteins. Smaller proteins migrate faster than larger proteins. Also, quaternary structure is preserved, so a dimer will run as a dimer so the percentage of total acrylamide monomer used is usually lower than what is used for SDS-PAGE, e.g. 7.5% acrylamide
11.
The temperature of a body of water influences
vegetation patterns
global warming
the formation of deserts
the temperature of the air above it
2 True or False. A projectleie an object that once set in motion continues in motion by its own martia O True False
Answer:
The answer is true.Explanation:PARTICLES MOVING ALONG THE PATH POSSES A TWO DIMENSIONAL MOTIONMARK ME AS BRAINIST PLZ
The suprachiasmatic nuclei enable the nervous system to respond to daily light/dark alterations through their stimulation of
Answer:
The suprachiasmatic nuclei enable the nervous system to respond to daily light/dark alterations through their stimulation of melatonin.
Explanation:
Melatonin is a hormone produced naturally by the body. Its function is to regulate the body's circadian cycle. This hormone is stimulated and begins to act by changing between a light environment and a dark environment. This stimulation interacts with the suprachiasmatic nuclei making the nervous system understand this change and luminosity of the environment and respond to the action of melatonin.
animal cell vs plant cell
Answer:
animal cell
Explanation:
Complete each sentence.
a. Cross-bridge binding triggers the release of ATP hydrolysis products from _________, and produces the _______ which generates force.
b. Ca2+ binds to _____________ on the thin filaments, causing tropomyosin to move away from its blocking position, thereby uncovering cross-bridge binding sites on ____________
c. Energized portions of myosin molecules called ________________ bind to actin.
d. __________________ binds to myosin, breaking the linkage between actin and myosin and thereby allowing the cross-bridges to ________from actin.
Answer:
Plzz upload a full picture of ur chapter
Which of these molecules are used for short term energy by
organisms?
Select one:
a. Proteins
b. Nucleic Acids
O c. Carbohydrates
d. Lipids
Describe the impact of technology on the environmental today
Explanation:
Other detrimental effects include diseases such as typhoid and cholera, eutrophication and the destruction of ecosystems which negatively affects the food chain. Resource depletion is another negative impact of technology on the environment. It refers to the consumption of a resource faster than it can be replenished
how is the oxygen cycle disturbed by deforestation
Answer:
If deforestation is disturbed then the photosynthesis cycle is disturbed, which results in the oxygen cycle being affected. With a decrease in trees, a decrease in photosynthesis occurs, which cause a decline in the oxygen cycle. A decline in the oxygen cycle results in more polluted air.
Explanation:
Without trees, humans would not be able survive because the air would be unsuitable for breathing. Due to deforestation, there would be fewer trees to "clean" the air. Deforestation is the action or process of clearing of forests, or the state of having been cleared of forests.
Trees and plants, in general, produce energy for growth using a process known as photosynthesis. Using light, water and carbon dioxide, a plant produces energy in the form of sugar and releases oxygen into the air.
Deforestation, as well as a rise in the emissions and our global temperature, affects the air that we breathe. This is because all trees take in carbon dioxide and other pollutants which are known to cause a lot of problems in the atmosphere and to humans. This inevitably results in people breathing dirtier and more polluted air that normally wouldn't happen.
Long-term exposure to polluted air can have permanent health effects such as: Accelerated aging of the lungs. Loss of lung capacity and decreased lung function. Development of diseases such as asthma, bronchitis, emphysema, and possibly cancer.
Trees are responsible for taking the carbon from the atmosphere through photosynthesis in order to make energy. This carbon is then either transferred into oxygen and released into the air by respiration or is stored inside the trees until they decompose into the soil. Therefore, the absence of trees would result in significantly higher amounts of carbon dioxide in the air and lower amounts of oxygen. This bad quality air would also be full of airborne particles and pollutants like carbon monoxide, sulfur dioxide and nitrogen dioxide.
In addition to the decrease of oxygen in the atmosphere, it would allow excessive amounts of carbon dioxide to remain. In the short term, since CO2 is one of the major greenhouse gases, it will undoubtedly lead to higher global temperatures which, in turn, would quicken the melting of the polar ice caps.
The extinction vortex represents the idea that even if an organism is extant, it may have a gene pool that will not support its long-term survival.A. TrueB. False
Answer:
True.
Explanation:
Extinction vortex is a model used by scientists to understand extinction dynamics within a community. This model allows scientists to assess and understand how a population can become highly vulnerable to elements of its habitat, becoming increasingly apt for extinction. According to this model, any organism is capable of extinction, as all are susceptible to having a gene pool that will not allow its survival, regardless of the environment.
Which of the following could be a characteristic of the fossil that is most closely related to humans? S-shaped back bo...
Answer: S-shaped back bo
Explanation: That was the only choice
Answer:
S-shaped back bone
Explanation:
pls mark as brainlists
What are the best management practices for Maize grain crop, by adopting which we can boost yield, elaborate in details your expert opinion.
Answer:
Cultivate prime grain and with timely care
Antennae development in ants is thought to be a trait controlled by maternal effect. In ants, zig-zag coils are dominant to curly coils. Assume that a female develops zig-zag coils. What can be determined about inheritance of this trait in her family?
a. Her mother has zig-zag antennae.
b. Her brother has zig-zag antennae.
c. This female carries the zig-zag allele
d. This female's offspring will have zig-zag antennae.
Answer:
a. Her mother has zig-zag antennae.
b. Her brother has zig-zag antennae.
Explanation:
Available data:
Antennae development ⇒ controlled by maternal effectZig-zag coils are dominantCurly coils are recessiveA female develops zig-zag coilsMaternal effect: Refers to the influence of the “environment provided by the mother” on the progeny phenotype. The mother´s genotype directly determines the progeny phenotype. Even though the progeny has a different genotype, it is irrelevant, as well as the father´s genotype or phenotype. This means that no matter what is the genotype of the offspring, all of them will express the same phenotype as their mother. The maternal effect is commonly seen in insects and might be seen in some mammals and plants.
So, if a female has zig-zag coils, this means that the mother also has zig-zag antennae and that all the brothers and sisters of this female ant have zig-zag antennae, independently of their genotype.
a. Her mother has zig-zag antennae ⇒ True. The trait is inherited from the mother.
b. Her brother has zig-zag antennae ⇒ True. The whole progeny will express sig-zag antennae.
c. This female carries the zig-zag allele ⇒ Not necessarily.
d. This female's offspring will have zig-zag antennae ⇒ Depends on it´s genotype
3a) label the structure of bacterium below i-vi
Answer:
I. Cell capsule
II. Cell wall
III. Plasma membrane
IV. Nucleoid
V. Cytoplasm
Explanation:
In the structure of bacterium, I represent Cell capsule which is the outer covering of bacterium cell, II is the Cell wall that is located after the cell capsule. III is the Plasma membrane which is also called cell membrane which is the second boundary of cell. IV represents Nucleoid which like nucleus having genetic material, V is Cytoplasm that is responsible for the transportation medium for various nutrients..
In a certain population, the allele causing sickle cell anemia has a frequency of 0.2. If the population is in genetic equilibrium for this allele, what fraction of the population would be heterozygous for this gene
Answer:
32% population would be heterozygous for this gene.
Explanation:
Due to technical problems, you will find the complete explanation in the attached files
Differentiate between pathogenicity and hypersensitivity; Also write different methods of inoculating the plants.
Answer:
As nouns the difference between pathogenesis and pathogenicity. is that pathogenesis is the origin and development of a disease while pathogenicity is the quality or state of being capable of causing disease.
Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!
Complete question:
Use the sequence below to answer the following questions
3’-ACGGATCCTCCCTAGTGCGTAATACG-5’
5’-TGCCTAGGAGGGATCACGCATTATGC-3’
1. Enter the sequence of the coding strand with a 5’-3’ polarity
Answer:
coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´
Explanation:
When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.
The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.
When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.
The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.
Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.
So, in the exposed example we have two strands, but we do not know yet which one is the coding one.
Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.
First-strand:
3’-ACGGATCCTCCCTAGTGCGTAATACG-5’
let us write it is 5´to 3´direction
5´- GCATAATGCGTGATCCCTAGGCA -3´
now let us identify the start and stop codons in 5´⇒3´direction.
Start codon ⇒ ATGStop codon ⇒ TAA, TAG, TGA5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning
5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons
Second strand: We will do exactly the same procedure
5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end
5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning
What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.
So, the sequence of the DNA coding strand with a 5-3 polarity is
5´- GCATAATGCGTGATCCCTAGGCA -3´
