What happens to water (H2O) and carbon dioxide (CO2) during photosynthesis?

Answers

Answer 1

Answer:

Carbon dioxide turns into glucose and water turns into oxygen

Answer 2

Explanation:

carbon dioxide is combined wih hydrogen atoms in the presence of ATP molecules to form glucose

water molecules split by sunlight energy to form oxygen gas and hydrogen atoms . the oxygen obtained from water is released by the leaf as a by- product


Related Questions

What technologies could the state use to lessen its flood risk?

Answers

Explanation:

they include floodwalls/seawalls, floodgates,levees, and evacuation routes. Nonstructural measures reduce damage by removing people and property out of risk areas. They include elevated structures, property buyout, permanent relocation, zoning, subdivision, and building

Answer:

My state could help prepare for future floods by using weather-detection technologies and building canals to divert overflowing rivers.

Explanation:

Which biome is characterized by plants that drop their leaves in the winter?

Answers

Answer:

Temperate Deciduous Forest Biome

Temperate Deciduous Forest Biome

This biome is named for the dominant trees that drop their leaves during the winter months. These forests may have an overstory of 20–30 m tall trees, an understory of 5–10 m trees and shrubs, a shrub layer around 1–2 m in height, and a ground layer of herbaceous plants.

Explanation:

how does the body's organization enable it to function

Answers

Answer:

All of the body's internal organs and systems rely on each other to function in harmony and this is what enables the body to function

Explanation:

What would normally happen after a new Chinese dynasty came to power?
A.
A new astronomer would be appointed.

B.
The new dynasty would continue on with the previous calendar.

C.
Star catalogues would be updated.

D.
Guest stars would begin to appear in the night sky.

Answers

China had various dynasties throughout the years and had heritable monarchial administrations that ruled over China for many years. The major dynasties were Shang, Zhou, Han Sui and many others.

A new astronomer would be appointed after a new Chinese dynasty came to power.

What happens in the establishment of a dynasty?

With the change and rise in cultural, political and economic powers and variations, the dynasties changed and established to set the new rule and ruler.

Whenever a new dynasty establishes the astronomer is replaced with a new one. They were appointed to maintain the record of the time and to make the Chinese calendars.

Thus, option A is correct.

Learn more about Chinese dynasties here:

https://brainly.com/question/26379290

Refer to the graphs below. Determine the type of forest these moths inhabit. Use evidence from the Peppered Moth simulation and the graphs as well as scientific reasoning to support your response. l

Answers

Answer:good right

Explanation:

Which is not a type of crystal system?
A. hexagonal
B. monoclinic
C. orthorhombic
D. triangular

Answers

Answer:

D. the answer is triangular

As you increase altitude, air pressure increases.
True
False

Answers

Answer:

pressure decreases with increasing altitude.

Explanation:

Hope this helps sorry if incorrect

Which one is the true answer

Answers

Carlos is correct, because sedimentary rock form under a lot of pressure

HELP WILL GIVE BRAINLIEST

Answers

Answer:

70000

Explanation:

i have to o sciece

If two organisms are in the same order, which statement is also true?
A. Same species
B. Same family
C. Same genus
D. Same class

Answers

Same class, it is the higher level in the hierarchy just above order :)
The answer is Same class

A chewing insect damages the vascular tissue of a plant system. This damage will most directly affect the

Answers

Answer:

Conduction of water and minerals between the roots and leaves

Explanation:

- EIjiro

1. Which of the following is true of cell energy?
O A. All organisms do some form of cellular respiration
B. Only some organisms undergo cellular respiration.
C. Since plants use photosynthesis they do not use cellular respiration
O D. Anaerobic respiration creates more energy than aerobic respiration,

Answers

Answer:

A. jabsjsushsbsjizisbsbsjsisjsnsn sjsbbd dhdbbdbs. djsbsbd djsjbs d

PLEASE HELP .............

Answers

Answer:

white spruces, red foxes

Explanation:

The reproductive strategy when hatchlings are able to move and
feed themselves​

Answers

Explanation:

Precocial development The reproductive strategy in which hatchlings of birds are able to move and feed themselves.

Need help!!!!! I need this page solved !!

Answers

Answer:

1. Igneous

2. Compacting and cementation

3. Igneous

The most amount of energy is available at what level of an energy pyramid?

Answers

Large amount of energy is available at the level of Producers

define ammonotelism?​

Answers

Answer:

The process where certain organisms excrete nitrogenous waste in the form of ammonia is known as Ammonotelism.

Explanation:

Ammonotelism is the process of excretion of ammonia and ammonium ions. Such animals are called ammonotelic.

A private reptile breeding facility near the Everglades was destroyed by Hurricane Andrew in 1992. This event contributed to the original influx quantities of pythons in the wild. Pet owners also contributed to the introduction of these reptiles to the Everglades by releasing pets that had grown too large to care for. These reptiles are considered species to this ecosystem.

can someone please write an explanation that describes the impact of the Burmese python on the Everglades?

Claim:

Evidence:

Reasoning:

Answers

Answer:

Claim:

The increase in the population of the Burmese python in Everglades is affecting the ecosystem of said area. They are an invasive species.

Evidence:

From 1994 to 2007, the Burmese python population increased from a small number below 50 species to more than 250 by 2007. As the Burmese population increased, the mammals' population in Everglades decreased significantly and even had extincted some species. For example, from 1993 to 1999, there were 64 white-tailed deer and five red foxes, and grey foxes. Between 2003 and 2011, there were 24 white-tailed deers and 0 foxes. Overall, there is a decrease in all mammals.

Reasoning:

The increasing number of Burmese Pythons due to the release of them by pet owners and due to the destructions of a private reptile breeding facility left a high number of pythons in the wild. As a consequence, these pythons ate other animals producing an imbalance in the Everglades ecosystem. Owing to its large number and how they are harming the ecosystem, they are considered an invasive species.

Explanation:

After analyzing the information, the claim is that the increasing population of pythons harms the Everglades' ecosystem.

The evidence that supports the claim is present in the graphics, where we can see how the population of this reptile grew over the years, and the mammals' population decreased. There is specific information about the reduction in the number of mammals in the area, such as the raccoon, foxes, rabbits, etc.

After presenting the evidence, the reasoning that we can make is that the pythons are killing the other animals in Everglades. Also, we can see that they are not a native species from the area since they were released by pet owners and by a breeding facility by accident. The fact that they are harming the Everglades' ecosystem and that they are not native species makes them an invasive species.

In humans, we have ____ pairs of autosomes and ____ pairs of sex chromosomes.
A. 1 and 22
B. 23 and 1
C. 22 and 1

Answers

Answer:

C, 22 pairs

Explanation:

Humans have 22 pairs of autosomes

? Help please would appreciate it

Answers

Answer:

It is acaully true.  

Explanation:

A gray-eyed alien and her black-eyed husband want a white-eyed baby.
Is it possible for a gray-eyed alien and her black-eyed husband to have a white-eyed baby?

Answers

Answer:

Yes, this is very possible.

Explanation:

kenrflkerfnlerfer

How does gene expression differ between human fibroblasts and induced pluripotent stem cells (iPS)?

Answers

Answer:

Both have different gene expression due to produce from different sources.

Explanation:

Gene expression is different between human fibroblasts and induced pluripotent stem cells because both cells are formed from different sources. Human fibroblasts is produced from ''mesenchyme'' a type of connective tissue whereas induced pluripotent are the stem cells which can be produced from adult cells so we can say that both have different gene expression.

Both have different gene expression due to produce from different sources.

The following information should be considered:

Gene expression is different between human fibroblasts and induced pluripotent stem cells since both cells are created from different sources. Human fibroblasts is generated from ''mesenchyme'' a type of connective tissue while on the other hand,  induced pluripotent are the stem cells that could be generated from adult cell.

Learn more: https://brainly.com/question/20492533?referrer=searchResults

Between a phylum, kingdom, order and family, which would be the MOST
Canspecific level of classification?
A.Family
B.Phylum
C.Kingdom
D.Order

Answers

Answer: phylum i hope i speled that right

Explanation: The most general category in taxonomic classification is domain, ... by subsequent categories that include phylum, class, order, family, ... The kingdom Animalia stems from the Eukarya domain.

n the picture below, what are biotic factors?

Answers

All of the above are biotic factors

5. In what way are ferns and mosses alike?
A. They are flower-bearing
B. They are spore-bearing
C. They have vascular bundles
D. They have roots, stems and leaves​

Answers

Answer:

the is A

Explanation:

Answer:

option B

they are spore bearing

hope it helps

what are some precautions for osmosis experiment ( using potato strips)? .. Really in need of your help ​

Answers

Answer:

this helped me in my test hope it helps you

Explanation:

https://youtu.be/oieXYuQm_xE

which one of the following answers has clear ectoplasm, pseudopodium, nucleus, contractile vacuole, cell membrane, and granular endoplasm
A.Protista
B.Animalia

Answers

B . Animalia is the answer for your answer
The answer is b if you’d didn’t know

What is the difference in height between low tide and high tide on Wednesday?

Answers

Answer:

I know it's called a tidal range I really can't see the picture sorry

Explanation:

Name 3 organisms that would be classified as eukaryotic multicellular and heterotroic

Answers

Answer:

PROTIST, FUNGI, PLANTS

Explanation:

The Protist Kingdom consists of mostly unicellular organisms that can have characteristics similar to plants, animals or fungi. Characteristics of Protists: mostly unicellular, few multicellular, eukaryotic, can be heterotrophic or autotrophic. Ex: algae, Paramecium, kelp (multicellular).

The three types of organism that would be classified as eukaryotic multicellular and heterotroic should be protist, fungi, and plants.

What is the Protist Kingdom?

It should treated as the unicellular organisms that contains the attributes,  similar kind of the plants, animals, or fungi.

The attribute of protists involved the unicellular, less multicellular, eukaryotic, heterotrophic or even autotrophic.

These organisms are classified together since they are made up of eukaryotic cells.

Therefore, the above should be considered as the protist, fungi, and plants.

Learn more about an organism here: https://brainly.com/question/11648445

What phyla is this animal?





Platyhelminthes

Nematoda

Annelida

Cnidarian

Answers

Answer:

Annelida

Explanation:

Hope this helps

Other Questions
n the railroad accident, a boxcar weighting 200 kN and traveling at 3 m/s on horizontal track slams into a stationary caboose weighting 400 kN. The collision connects the caboose to the car, and then both move together and you have found the final velocity. Apparently, initial kinetic energy of the system changes (in part, because of friction present). How much energy (in kJ) is transferred from kinetic energy to other forms of energy (e..g., thermal) in the collision |x + 2| if x > -1. Pls help In a family with parents who do not have hemophilia, one son has hemophilia. Who was the carrier of the gene for hemophilia?*if possible, I also need a Punnett square * __C+_SO2_CS2 + __CO Which ecosystem would be affected the most by losing its butterflies, and why? A. Ecosystem 2 because it has more kinds of plants, animals, and insects. B. Ecosystem 1 because it has more plants that depend on the butterfly. C. Ecosystem 2 because it has more insects that compete with the butterfly. D. Ecosystem 1 because it has fewer kinds of plants, animals, and insects. How could the differences in geography and economic activities create tensions between the regions of the United States listed? Explain 15% of 20 is ??? please helpp What is the distance between (3,7) and (-3,-1) ? 1) How many organs of central government are there? Name them A uniform electric field exists in a region between two oppositely charged plates. An electron is released from rest at the surface of the negatively charged plate and strikes the surface of the opposite plate, 2.0 cm away, in a time 1.5 x 10-8 s. The speed of the electron in millions m/sec as it strikes the second plate is: A. 13.3 B. 133 C. 2.67 D. 26.7 E. 534 In the late1890s, who created a support system to help African American businesses? Jim Crow Pat McCrory W.C. Coleman A.M. Waddell Please Help ASAP before midnight. Write a unit rate for the situation.$12.50 for 5 ouncesAlso if you can, with your answer can you tell me how to find unit rate? A pyramid with an equilateral-triangle base has a volume of 48sqrt{3} cm3 and a height of 16 cm. Find the length of each side of the equilateral triangle.You get brainliest, i need answers fast. How was religion in ancient Rome similar to religion in ancient Greece? (Choose 3)ARoman gods had the same names.BRoman gods had human-like qualities.CRoman religion was polytheistic.DRoman gods were different aspects of one God.ERoman religion included a holiday called Saturnalia.FRoman gods played an important role in everyday life by protecting families, homes, farms and even animals. Rewrite the number in Standard form6 x 10^8 What is the main source of winds and weather? A. The spinning EarthB. The Earth's rotation on its axisC. The layers of the planetD. The sunI will mark correct answer brainliest 3+4-8+9-8+78+99-7999+8799+06997+90797883+677_5= May someone help me with this :) Describing Work ActivitiesNote that common tasks are listed toward the top and less common tasks are listed toward the bottom.According to O*NET, a pharmacy technician should be able to use computers to enter, access or retrieve data to adhere to safety procedures and use the metric system.What Work Activities are being described? Check all that apply.a. processing informationb. getting informationc. interacting with computersd. evaluating information to determine compliance with standardse. identifying objects, actions and eventsf. updating and using relevant knowledge 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA