Answer: radiation
Explanation:
Answer:
Radiation
Explanation:
plants need radiation to produce sunlight in order for them to carry out photosynthesis
the type needed is photosynthetically active radiation (PAR)
Which of the following is true about CO_2CO
2
?
A
It does not have much effect on the climate.
B
It is a greenhouse gas.
C
Very little CO_2CO
2
is being emitted now.
D
If we cut CO_2CO
2
emissions by half, the temperature will stop rising.
Answer:
B.
Explanation:
It has a huge impact on the environment
It is being emitted in large amounts
And if we cut our carbon emissions in half it would delay the risk of raising the global temperature of 1.5 degrees Celsius but half of it would still pumped into the atmosphere along with the carbon dioxide already in the atmosphere.
But it is a greenhouse gas because it helps trap the heat remaining in Earth's atmosphere which is why the Earth is warming.
CO2 is a greenhouse gas.
what are greenhouse gases?
Greenhouse gases are gases in the atmosphere that affect the energy balance of the planet. The greenhouse effect is caused by them. Carbon dioxide (CO2), methane, and nitrous oxide, the most well-known greenhouse gases, can all be present in low concentrations in the environment.
The greenhouse gases in the atmosphere trap heat and warm the earth.
Carbon dioxide, methane, nitrous oxide, and water vapor (all of which exist naturally) are the principal greenhouse gases, as are fluorinated gases (which are synthetic).
Carbon dioxide (CO2) is released into the atmosphere as a result of the combustion of fossil fuels (coal, natural gas, and oil), solid waste, trees, and other biological materials, as well as chemical processes (e.g., manufacture of cement). As part of the biological carbon cycle, carbon dioxide is absorbed by plants and released from the atmosphere.
hence, CO2 is a greenhouse gas.
To know more about greenhouse gas here
https://brainly.com/question/14131369
#SPJ2
how is cancer cell division different from regular cell division
What are chromosomes? How are they different between prokaryotes and eukaryotes?
Answer: A chromosome is a long DNA molecule with part or all of the genetic material of an organism. The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not
Explanation:
Chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.
Chromosome:
It is a long thread of DNA molecule as a part of genetic material of all living organisms.
In prokaryotes, DNA is not very much compacted.Only one chromosome is usually scene in prokaryotes.In Eukaryotes, Chromosome are very compacted and form an special structure.Multiple chromosomes are found in Eukaryotes.
Therefore, chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.
To know more about Chromosomes,
https://brainly.com/question/296477
I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.
What is true about the water sample?
Choose 1 answer:
(Choice A)
A
It is basic.
(Choice B)
B
It is acidic.
(Choice C)
C
It is neutral.
(Choice D)
D
It is both basic and acidic.
Answer:
it is Basic brooooooo. No B NOT C AND NOT D. oNly A
The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)
FIND THE INDEPENDENT & DEPENDENT VARIABLE!
- the amount of iron in blood depends on the amount of red meat a person eats.
Answer:
The answer is:
Independent: red meat eaten by a person
Dependent: iron in the blood
Explanation:
A dependent variable has to depend on something else, so in order for a dependent variable to exist or happen, there has to be the independent variable. The independent variable is something that does not need anything else to happen for it to take place. It s independent. Such as, a mother cannot have a child without sperm. The mother have a child is dependent, where the sperm is independent.
Please help me on this question
Which activity can be accomplished using the genetic code?
O A polypeptide can be made into mRNA
. DNA can be made into mRNA
O RNA can be copied before mitosis.
O mRNA can be made into tRNA
Answer:
DNA can be made into mRNA
Explanation:
once, more than once, or not once, more than once, or not at all.
This group of questions refers to molecules of the following substances.
(A) Cytochrome
(B) FADH
(C) NAD
(D) NADP
(E) Oxygen (02)
Answer:
a
Explanation:
Two molecules of ATP are generated for every one molecule of glucose in ... a cell needs more NADPH than it does ribose 5-phosphate. ... Practice: Which one of the following is NOT a potential fate of pyruvate ? a.
Please also describe how actin-binding sites are made available for cross-bridging with myosin heads during contraction.
Answer: The calcium ion binds to troponin, and this slides the tropomyosin rods away from the binding sites.
Explanation:
Contraction and relaxation of muscle cells brings about movements of the body. The contractile myofilament called sarcomeres are bounded at each end by a dense stripe called the Z - line, to which the myosin fibres are attached, and lying in the middle of the sarcomere are the actin filaments, overlapping with the myosin.
When action potential spreads from the nerve along the sarcolemma (muscle cell membrane), it penetrates deep into the muscle cell through the sarcoplasm (cytoplasm of muscle cell), and releases CALCIUM from the intracellular stores.CALCIUM triggers the binding of myosin to the actin filament next to it forming CROSS BRIDGES.
For this to occur, ACTIN BINDING SITE has to be made available. TROPOMYOSIN is a protein that winds around the chains of the actin filament and covers the myosin-binding sites to prevent actin from binding to myosin. The first step in the process of contraction is for calcium ions to bind to troponin so that tropomyosin can slide away from the binding sites on the actin strands.
George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes
Answer:
A - peanuts, sweet potatoes, and soy
Explanation:
Answer:
I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...
Explanation:
You have adopted a gray mouse, which you know is a wild type phenotype. When crossed with a white mouse, your gray mouse has a first litter of 3 gray mice and 2 white mice. In the second litter, you observe 3 gray mice and 4 white mice. What is the probable genotype of your gray mouse
5. The lion researchers in the film have studied 20% of the park and identified 41 lions. (Show your
work/justify your answer for each section.)
a. The entire Gorongosa park is 4,000 km². Approximately how large (in km) is the portion of
the park that has been studied?
ASAP PLSS
Answer:
800 km²
Explanation:
If the researchers have studied 20% of the 4000 km² park, to find out how much of the park in km they have studied, all you have to do is find 20% of 4000.
4000 x .20 = 800
800 km² is your answer.
If the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].
What do you mean by the researcher?A researcher may be defined as a kind of person who significantly carries out academic or scientific research in order to find some unrevealed data and information.
According to the question,
The total area of Gorongosa park = Gorongosa park is 4,000 km²
The area which is already studied = 20%.
Now, you have to find the area that is already studied in km. So, you have to calculate the 20% of 4,000 km².
The area which is already studied = 4000 × .20 = 800 [tex]km^2[/tex].
Therefore, if the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].
To learn more about Researchers, refer to the link:
https://brainly.com/question/28136063
#SPJ2
What is the definition of "earth overshoot day?"
Answer: Earth Overshoot Day is the calculated illustrative calendar date on which humanity's resource consumption for the year exceeds Earth’s capacity to regenerate those resources that year. The term "overshoot" represents the level by which human population overshoots the sustainable amount of resources on Earth.
Which atom is involved in giving your heart energy to beat?
O carbon
O gold
O oxygen
O iron
Answer:
Oxygen
Explanation:
-How fast the heart beats depends on the body's need for oxygen-rich blood. At rest, the SA node causes your heart to beat about 50 to 100 times each minute. During activity or excitement, your body needs more oxygen-rich blood; the heart rate rises to well over 100 beats per minute.
-The heart, like any organ, requires blood for oxygen and other nutrients so it can do its work. The heart does not gather oxygen or nutrients from the blood flowing inside it. Instead, it receives blood from coronary arteries that eventually carry blood into the heart muscle.
In which experimental set up shown would you expect the Elodia plant inside a test tube to produce the least amount of oxygen
Answer:
Due to less concentration of carbondioxide gas.
Explanation:
Elodia plant inside a test tube produces the least amount of oxygen due to limited carbondioxide gas that is necessary for photosynthesis process. If a test tube has less amount of carbondioxide gas which is a reactant in photosynthesis so in the end the Elodia plant generates less amount of glucose as well as oxygen while on the other hand, if there is more carbondioxide gas is available to Elodia plant, more oxygen as well as glucose is produced.
The F1 mother of these progeny (F2) resulted from a cross between two flies from true breeding lines (P generation). What are the genotypes of these two lines
The question is incomplete. The complete question is :
In fruit flies, the recessive pr and cn mutations cause brown and bright-red eyes, respectively (wild-type flies have brick-red eyes). The double mutant pr cn combination has orange eyes. A female who has wild-type eyes is crossed to an orange-eyed male. Their progeny have the following distribution of eye colors:
wild-type8
brown241
bright-red239
orange12
500
The F1 mother of these progeny (F2) resulted from a cross between two flies from true breeding lines (P generation). What are the genotypes of these two lines ?
Answer:
prprcn+cn+ and pr+pr+cncn
Explanation:
Progeny is the offspring or descendants of any animal, plant, human or a species.
In the context, it is given that the cn mutation and recessive pr in the fruit flies makes brown and bright red color eyes. And the double mutant of pr and cn combination makes orange eyes. An oragne eye males is crossed with a female having a wild type eyes. Now for this, the F1 mother of the progeny F2 which results from the cross of two flies, the genotypes is " prprcn+cn+ and pr+pr+cncn. "
The baker mixed yeast in the dough and kept it away for the night , The next morning it had risen high up , Explain how this happened
Explanation:
Maybe this can help.
In bread making (or special yeasted cakes), the yeast organisms expel carbon dioxide as they feed off of sugars. As the dough rises and proofs, carbon dioxide is formed; this is why the dough volume increases.
What is RNA primase's job?
-removing a few bases for DNA polymerase
-add a few bases for DNA polymerase
-removing a few bases for helicase
Answer:
The correct answer is - add a few bases for DNA polymerase
Explanation:
A short extended nucleic acid composed of ssRNA molecule. This is a molecule that synthesize a primer initialy and later again lay down a primer after the opening of replication fork by DNA helicase.
It sysntheisze before and after the helicase and follow the helicase in order to prepare for the replication process. Thus, adding a few bases for DNA polymerase is main job of RNA primase.
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
What would make the water in a small region of the ocean more salty?
A. heavy rainfall over the region
B. melting an iceberg in the region
C. water from a river running into the region
D. evaporation of a lot of the water in the region
Answer:
Its C
Explanation:
Checked it and got it right
A stimulus is anything that causes a reaction or response. What is an example of an outside stimulus and an inside stimulus?
Answer:Stimulus: any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.
Explanation:
Answer:
hi
Explanation:
any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.
ALOT OF POINTS PLEASE HELP :)
How did humankind discover the presence of DNA?
Answer:
The real breakthrough in understanding DNA, however, came with the discovery of its structure in 1953. The discovery of the structure of DNA is often credited to James Watson and Francis Crick.
Explanation:
1.How does Nitrogen cycle through the enviroment?
2. Trace the steps that carbon cycles from plants,animal,and enviorment?
Answer: 1. The nitrogen cycle is a biogeochemical cycle.
2. The carbon cycle is a biogeochemical cycle.
Explanation:
1. The nitrogen cycle can be defined as the biogeochemical cycle in which the atmospheric nitrogen is utilized by the plants which is fixed by the soil bacteria. The nitrogen becomes the part of the biosphere as plants utilize it as an important development mineral. The nitrogen cycle involves the nitrogen fixation in which plants fix nitrogen by the help of bacteria into ammonia, nitrification in which the ammonia is converted into nitrite, nitrogen assimilation in which the plants assimilate and utilize the nitrogen for their growth and development, and denitrification involves the reduction of nitrite into atmospheric nitrogen. The conversion of nitrogen is carried out via physical and biological processes.
2. The carbon cycle involves the atmospheric carbon dioxide being circulated in plants as they utilize it for photosynthesis. The carbon dioxide is fixed by the plants in the form of carbohydrate which is consumed by the animals and on decomposition of plants and animals dead matter release carbon dioxide gas to the atmosphere. This allows the recycling of the carbon dioxide gas in the environment.
What is the medical term for the process or procedure that destroys or inhibits disease-causing microorganisms to prevent infection:
Answer: Sterilization.
Explanation:
Sterilization is the process that kills, or deactivates all forms of life so then a product is considered free of viable microorganisms. This process must be designed, validated and carried out to ensure that it is capable of eliminating the microbial load of the product.
Since sterility cannot be demonstrated without causing the complete destruction of the products, sterility is considered when the probability of a product being contaminated is acceptably remote. A critical product is considered sterile when the probability of a microorganism being present in an active or latent form is equal to or less than 1 in 1,000,000 (sterility safety factor 10^-6).
Agents that kill microorganisms are called microbicides or more commonly called "germicides". If the agent kills bacteria, it is called a bactericide. And if it kills fungi, then it is called a fungicide. It is important to consider than after an exposure of the sterilized object to the air or its surroundings, it will have become contaminated again with microorganisms.
Examples of sterilization include physical methods and chemical methods. Physical methods include:
Wet heat (in steam autoclave) Dry heat (in sterilization oven) Radiation (gamma radiatio, electron beam, X-ray, ultraviolet, microwave, white light)Chemical methods include a variety of chemicals in liquid and vapor form, for example:
Hydrogen peroxideChlorine dioxideOzone gasesEthylene oxidePropylene oxidePeracetic acidWhich best describes the blood flowing in an artery?
A. It is oxygen rich
B. It contains no red blood cells.
C. It moves toward the heart.
D. It is oxygen poor.
It is oxygen rich
What do you mean by arteries?
The arteries are the blood vessels that deliver oxygen-rich blood from the heart to the tissues of the body. Each artery is a muscular tube lined by smooth tissue and has three layers: The intima, the inner layer lined by a smooth tissue called endothelium.
What is oxygenated blood?
Oxygenated blood can be simply defined as a blood cell with large percentage of oxygen and low in carbon dioxide. It appears bright red in color and travels away from the heart to different parts of the body.
To learn more about arteries here
https://brainly.com/question/3306673
#SPJ2
Mistakes are sometimes made in duplicating or transmitting genetic information. These mistakes are called
Answer:
Mutation
Explanation:
Mutation is any alteration or change in the genetic sequence of a gene caused by mutagens (substances) or mistakes during replication of genetic sequences.
A mutation occurs in the gene from time to time, although, the cell has protocols in place to put them under control if they occur. However, when DNA or a gene is being copied and transferred to offsprings, there is bound for mistakes called MUTATION to occur.
Lab: Natural Selection answer in the link pls 50 points and
Can someone pleeaseeee helpppp!! I’ll mark the brainliest
Answer:
i think its C im not sure but normally in my opinion that would be correct
Answer:
natural selection: black moths had a higher chance of survival since they were more camouflaged from the pollution
Explanation:
please help with this question
Answer:
a -5
d -2
c-3
b-4
e - 5
Explanation:
I'm guessing this is the answer
Which description represents a medium?
a - energy that moves with a wave
b-midway point through a wave
c- a wave that can travel through a vacuum
d- material through which waves can travel