What is the main idea of "capturing the moment " by Gary Soto

Answers

Answer 1

The correct answer to this open question is the following.

Although there are no options attached we can say the following.

The main idea of "capturing the moment " by Gary Soto is the emotion Lisa feels when she got back home from school and she realizes that something is different. She looks at the area and finds that the pouring rain created a small lake. She is fascinated with the view and she decides to draw a picture. She likes to draw. So she knelt down on the muddy soil and takes a piece of paper from her bag. She grabbed a pencil and starts to draw the beautiful view. She is enjoying the moment with her dog "Pecas,"  when the phone rings. It is her mother asking her to do some chores such as thaw the meat. Then she goes back to reality.


Related Questions

What was the subject of Withencroft's sketch?

Answers

Answer:

August Heat

Explanation:

Hope this helps!

Write a letter to the principal pointing out at least three practice among student that should be discouraged

Answers

Answer: Cheating on a test, Being late to class, Interrupt someone, Sleep while class is in session

Explanation: These were the rules for the high school I went to. Also, I wrote 4 practices among students that should be discouraged because at my high school if I did more than I was expected to do I got extra credit.

Hope this helps :)

​​​​​​​

According to Friedan, women were taught to pity the neurotic, unfeminine, unhappy women who wanted _____.
to have husbands who could change diapers
to breastfeed and make fantastic snacks
to be poets, physicists, or presidents
to love themselves honestly

Answers

Answer:

According to Friedan, women were taught to pity the neurotic, unfeminine, unhappy women who wanted _____.

to be poets, physicists, or presidents.

Explanation:

The above assertion meant that women were not permitted to pursue careers.  They were taught to be satisfied with their roles in the family.  This is the argument that women should find fulfillment in their housework, marriage, sexual lives, and children.  Seeking higher education, pursuing careers, and involvement in political activism should be left for the male folks.  Friedan's argument was that the feminine mystique disadvantaged women greatly, both in their personal and professional lives.  Therefore, she advocated that women should seek personal achievement by pursuing professional careers.

C. to be poets, physicists, or make fantastic snacks

your marks wil be good​

Answers

Answer:

Do you mean?

5.) The further we get from the city, it becomes more quiet

What does the prefix 'under' in the word "UNDERESTIMATE" mean?

Answers

Answer:

1) verb- to estimate at too low a value, rate, or the like.

2) verb- to make an estimate lower than that which would be correct.

3) noun- an estimate that is too low.

Explanation:

hope this helps

NEED HELP ASAP PLEASE CORRECT = BRAINLIEST

Answers

Answer:

The first one: x= 3

The second one: b= 7

The third one: y= -2

The forth one: c= -3

Also, have a great day or night wherever your at. :)

Use the following sentence to identify the parts listed below. The white cat ran boldly up the stairs. adjective: adverb:

Answers

Answer:

Explanation:

Adjective: white

Verb: ran

And just in case,

Adverb: boldly

what does western business suit tell about the people who wear them​

Answers

Answer:

it tells us that they are very professional

Explanation:

The _______ step of the writing process entails coming up with ideas.
The planning step entails _______.
The most important element of your plan is the _______ statement.
One reason to build your vocabulary is _______.
Once you learned the meaning of a new word, you should _______.
It is important to know a word's _______ so you can use it properly compared to other words with similar meanings.
According to proper formatting, when you introduce another speaker into a dialogue, you must _______.
To sound natural, you should write as if you were engaged in a/an _______ with the reader.
Using _______ sentences sandwiched between long ones is an example of a technique you can use to make your writing more interesting.
One way to add impact to your writing is to place the most important idea at the _______ of a sentence.

Answers

Answer:

good, ideas, brain,be able to summarize it

Nicole wants to play the saxophone in the school band, but she feels too shy to audition.

What kind of conflict is this?

Answers

Answer:

Internal conflict

Explanation:

This conflict is between Nicole and herself. This is called a self vs self conflict, or an internal conflict.

the answer is internal conflict

Whatdo you think this quote means? "All my experience of the world teaches me that in ninety-nine cases out of a hundred, the safe and just side of the question is the generous and merciful side."
Anna Jameson 1794 - 1860, British Essayist​

Answers

Answer:

I think quote means to repeat or to copy .

yeah,it is experience totally.

It is experience from early in the morning till night .we experience it totally through out the life

As a verb, to quote means to repeat someone's words, attributing them to their originator. ... When you write out a quote, you put the other person's words in quotation marks (“Aha!”). Sometimes a price estimate is called a quote, like when a mechanic looks at your engine and gives you a quote for the cost of repair.

WHAT IS THE RIGHT
Adverbial Clauses Of Concession
Choose the correct answer


Although the colombian people have a good reputation abroad,...

A.They don't love our politicians.
B.They don´t love our coffe.
C.They don´t love our soap operas.
D.No choice.

Answers

The correct answer has to be D).

Answer:

D. No choice

Explanation:

An adverbial clause of concession should be something that contrasts with the main idea. None of the three choices offered contrasts with the idea that Colombian people have a good reputation abroad. A person can have a good reputation and also not love our politicians, coffee, or soap operas--there is no contrast here that would justify the use of the word "although."

PlEASE HELP! What does a poem with meter have that a poem written in free verse lack?

a rhyme scheme

a regular rhythm

a word that is repeated

a definite mood

Answers

Answer:

A free verse has rhyme but no rhythm. C. Because a free verse is prose, meter has no function. ... The poet adopts the rhythm of another poem for his own.

When planning a narrative essay, the writer should order events so that the ____ is developed in the middle of the essay.

Answers

Answer: Conflict
Because the middle of the essay is the climax which is the highest peak of the story meaning it will be CONFLICT and the rest of the story will be solving the conflict.
Hope This Helps

need this answered helppppppp

Answers

The answer to your question would be A
Answer is A I just did that test a couple mins ago!

Read the excerpt from John Muir's "Calypso Borealis" and answer the question.
[1] After earning a few dollars working on my brother-in law's farm near Portage (Wisconsin), I set off on the first of my long lonely excursions, botanising
in glorious freedom around the Great Lakes and wandering through innumerable tamarac and arbor-vitae swamps, and forests of maple, basswood, ash,
elm, balsam, fir pine, spruce, hemlock, rejoicing' in their bound wealth and strength and beauty, climbing the trees, revelling in their flowers and fruit like
bees in beds of goldenrods, glorying in the fresh cool beauty and charm of the bog and meadow heathworts, grasses, carices, ferns, mosses, liverworts
displayed in boundless profusion.
[2] The rarest and most beautiful of the flowering plants I discovered on this first grand excursion was Calypso borealis (the Hider of the North). I had been
fording streams more and more difficult to cross and wading bogs and swamps that seemed more and more extensive and more difficult to force one's
way through. Entering one of these great tamarac and arbor-vitae swamps one morning, holding a general though very crooked course by compass,
struggling through tangled drooping branches and over and under broad heaps of fallen trees, I began to fear that I would not be able to reach dry ground
before dark, and therefore would have to pass the night in the swamp and began, faint and hungry, to plan a nest of branches on one of the largest trees
or windfalls like a monkey's nest, or eagle's, or Indian's in the flooded forests of the Orinoco described by Humboldt.
[3] But when the sun was getting low and everything seemed most bewildering and discouraging, I found beautiful Calypso on the mossy bank of a
stream, growing not in the ground but on a bed of yellow mosses in which its small white bulb had found a soft nest and from which its one leaf and one
flower sprung. The flower was white and made the impression of the utmost simple purity like a snowflower ...
In a paragraph of 3-5 sentences, explain how Muir views nature. Support your answer with two examples from the passage. Explain how each example
reveals his view of nature.

Answers

Answer:

Muir views nature as a place of freedom, exploration, and adventure.

He describes his first botanizing excursion as a moment of "glorious freedom" in which he can explore its beauty. His use of words reflect that feeling even when he´s talking about the hardships of the experience:

Explanation:

The description of the difficulty when fording streams and wading swamps reflects a sense of adventure more than one of despair.

Then, there´s a bad situation, which is indicated by words such as "bewildering" and "discouraging," but then he describes the Calypso found on a stream, usually a nice location, and phrases such as "bed of yellow mosses," "small white bulb," and "soft nest" all represent a nice situation.

how did early people calculate​

Answers

Answer:

Early people used things like their fingers, notches in sticks, knotted threads, and stones to count and do rudimentary computations. To do arithmetic, most early societies developed some sort of counting board or abacus.

OAmalOHopeO

I could feign that there was no world, I could not feign that I did not exist. (chapter 4, paragraph 3; Discourse on Method) Based on this context, the word feign most likely means: deny, argue, pretend, believe

Answers

I’m pretty sure the word feign means pretend

Evaluate Metaphors for Making Things New
Which metaphor for life do you think creates the
best mental image? Check the metaphor you
agree with
a box of chocolates
a river
a maze
a puzzle

Answers

I would say a puzzle, because at first it’s not really anything, then you put it all together and it makes something new, you put the pieces together and get an image.

Answer: everything is correct lol

Explanation:

BEST ANSWER GETS BRAINLIEST!!
Read the following poem and then respond to the question below:

"I'm Nobody! Who are you?" By Emily Dickinson

I'm Nobody! Who are you?
Are you – Nobody – too?
Then there's a pair of us!
Don't tell! they'd advertise – you know!

How dreary – to be – Somebody!
How public – like a Frog –
To tell one's name – the livelong June –
To an admiring Bog!

In this poem, Emily Dickinson describes what it is like to be "Somebody." In a paragraph of four to six sentences, explain how the poet feels about being "Somebody" and use specific examples from the poem to support your interpretation.

Answers

This sentence supports my answer '' How dreary – to be – Somebody!'' Dreary means are depressing/dull. Depressing/dull are not happy words. If the poet wanted to be ''Somebody'' they would have said something like How fantastic to be somebody. The poet strongly disapproves of being ''Somebody.''

What is the main message of I'm nobody who are you?

The poem may be summarised very simply as being about how it is actually quite nice to be a Nobody rather than a Somebody – that anonymity is preferable to fame or public recognition.

Learn more about Emily Dickinson here: brainly.com/question/25332344

#SPJ2

What is an omniscient point of view?

Answers

Answer:

The Narrator. The third-person omniscient point of view occurs when the story is told by a narrator who is all-knowing and all-seeing.

Answer:

a limited point of view

Explanation:

Guided Practice

Type your answer and then click or tap Done.


Add necessary commas to the following sentence.


You can find shoes furniture dishes fruits and vegetables at the market.

Make sure to type in the sentence exactly as given, with the necessary commas added.

Answers

Answer:

You can find shoes, furniture, dishes, fruits, and vegetables at the market.

Explanation:

Add in commas after each item in the list(except for the last item)



Q.3) Comment on ways in which the villagers regard Biju

Answers

Answer:

what is the chapter name

NEED HELP NOW!!! PLEASE in the boy who harnessed the wind how did environmental factors affect food production

Answers

Answer:

The could not grow any crops. This is because of a drought that consumes Malawi. William notices that friends are starving, people are dying, and parents are even selling their children into the marketplace for food. His family is forced to eat almost nothing each day. Another thing that William loses along with his sister is the privilege of going to school.

Happy learning!

--Applepi101

Answer: The could not grow any crops. This is because of a drought that consumes Malawi. William notices that friends are starving, people are dying, and parents are even selling their children into the marketplace for food. His family is forced to eat almost nothing each day. Another thing that William loses along with his sister is the privilege of going to school.

Explanation: due to the weather it afffected cliate and stuff growing and thats not safe....

What was the significance of the stonewall inn and surrounding neighborhood of greenwich village to the LGTBQ+ community in the 1960s

Answers

The June 1969 riots at New York City's Stonewall Inn marked a raucous turning point in the fight for LGBT rights. ... Police raids on gay bars were common, but on that particular night, members of the city's LGBT community decided to fight back—sparking an uprising that would launch a new era of resistance and revolution.

Organized systems of agriculture, the maintenance of herds of domesticated animals, and permanent, year-round settlements marked the_______________.
a.
Paleolithic Era
c.
Bronze Age
b.
Stone Age
d.
Neolithic Era

Answers

The answer is d Neolithic era hope this helps.

What is the structure of the following sentence?

I struggled to climb the hill, and I was grateful when my hiking partner extended a hand to help me.

Compound
Complex
Compound-Complex
Simple

Answers

Answer:

May be simple................,

Which of the following sentences is in the imperative mood?
O I wish I had found a good house for next autumn.
O Don't park your vehicle here.
Can you explain the life cycle of a honey bee?
O Will you follow the directions given in the catalogue?

Answers

Answer:

Will you follow the directions given in the catalogue?

Explanation:

I think, Sorry if this is wrong

Choose the word and phrase that correctly complete the ideas in the sentence.
Candace Whitcomb's organ playing and loud singing create
(a. humor b.tension c. irony d. confusion), and they affect the story by
(a. introducing an obstacle Alma must overcome
b. causing Alma to spoil her performance
c. reminding the church what they lost
d. preventing the church service from continuing)

Answers

Answer:

b. tension

a. introducing an obstacle Alma must overcome

Explanation:

The first question is easier. We can strike out the answers c and d, because they don't make sense at all. It could be humor, as some people are smiling, but b. tension is the better answer because of the follow-up question; it has negative words in the answers, such as "obstacle, spoil, lost, preventing". So tension is the best answer.

Excellent. The second question has 4 answers that are all factually correct. However, the question asks for how Whitcomb's organ playing and loud singing affect the story. This insinuates we should look for something "deeper", that affects the storyline in a broader manner. Answer choices b through d are all inconsequential, and are only related to the current performance (by the way, b and d are actually factually wrong; Alma's performance still goes on, sorry). Thus, only answer a, which mentions an obstacle (also known as a conflict) is important to the storyline as a whole.

Hope this helps!

The word and phrases that correctly complete the ideas in the sentence Candace Whitcomb's organ playing and loud singing create tension introducing an obstacle Alma must overcome. Thus the correct word is tension.

What is the theme of a Village singer?

The story of "A Village Singer" is about compassion and forgiving other people. Candace is first offended, but she soon comes to the conclusion that being rude is pointless. The story takes place in New England a town that is meant to be humble.

When Candace was removed from the band after forty years of faithful service, a local singer illustrates her internal conflict, hatred, and reaction. The social norm for women is reflected in the story.

The loud vocals and organ play of Candace Whitcomb elevate the stakes and introduce a hurdle for Alma to accomplish. As a result, the tale conveys the message of kindness and forgiveness.

Therefore, the word tension and the phrase introducing an obstacle Alma must overcome are appropriate.

Learn more about the theme, here:

https://brainly.com/question/12461958

#SPJ2

Turn in the passive voice


1. The interviewer asked me several questions

2. I am eating rice​

Answers

[tex]ohk[/tex]

1) Passive voice:- Several questions were asked to me by the interviewer.

2) Passive voice:- Rice is being eaten by me.

Turn in the passive voice

1. The interviewer asked me several questions

2. I am eating rice

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

Passive voice:-

1. Several questions were asked to me by the interviewer.

2.  Rice is being eaten by me.

[tex]\sf{   }[/tex]

Other Questions
Applying: Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTGAGACCTGGCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a. Which of the following is the solution set of 6x + 5 = -29? {-4} The probability that Sara wins a raffle is given by the expression n/n+3Write down an expression, in the form of a combined single fraction, for the probability that Sara does not win. Which headline is most likely to be included on a national news show?A. Local school raises $5,000 for cancer researchB. Iran declares war on the U.S.C. School in China raises $5,000 for cancer researchB. Company closes in Alaska, lays off 2 people Ibrahim likes to run a loop around the park near his house that is mile long. There is a water fountain way around the loop. Ibrahim stopped to get a drink of water at the water fountain. How far did Ibrahim run? Carbon monoxide, a product of combustion, is a toxic gas that has an extremely high affinity for hemoglobin (much higher than that of oxygen for hemoglobin); consequently, as soon as it dissolves in the liquid part of blood at low partial pressure, it diffuses quickly into red blood cells and binds to hemoglobin. In carbon monoxide (CO) poisoning, even with very low partial pressure of inspired CO, CO rapidly binds to hemoglobin (Hgb), leaving a lower fraction of oxygen binding sites on Hgb available to be occupied by oxygen. What would you expect to find if you measure the arterial PO2 of a person with CO poisoning Write about the urban local government bodies. Which of the following is one of the value gaps that can undermine customer experiences and can damage relationships?Service Quality GapsPsychological GapsLanguage GapsPhysical GapsOperational GapsTransition Gaps the product 17.10 Analyze the diagrams. Which quadrilateral is a trapezoid? Quadrilateral M N O L is shown. Sides M L and N O are parallel and sides M N and L O are parallel. Quadrilateral M N P O is shown. Quadrilateral A B C D is shown. Sides A D and B C are parallel. The doctrine of respondeat superior means that: a. the police are expected to respond immediately to all calls for service b. an employer may be held liable for the wrongful acts of its employees c. the federal court may assume jurisdiction over police misconduct suits involving constitutional violations d. police officers have sovereign immunity and cannot be sued for damages caused by their misconduct Bshehe svevsbehxuebxhebxhebdbdb The function g(x) = x2 is transformed to obtain function h: h(x) = g(x 3). Which statement describes how the graph of h is different from the graph of g? A. The graph of h is the graph of g horizontally shifted right 3 units. B. The graph of h is the graph of g horizontally shifted left 3 units. C. The graph of h is the graph of g vertically shifted up 3 units. D. The graph of h is the graph of g vertically shifted down 3 units. (Super urgent) I need to know which one of the 4 the answer is Frogs are released into a pond where there are no other frogs of this species. Thefunction f(t) can be used to model the population of this new species after t years.Below are 4 forms of the function that model this situation. Which form most clearlyshows the monthly population growth? the sale figures have been revised ....... due to the miscaculationa, significantb,significantlyc,significanced,signification Can someone help me? I am struggling and I would be so happy if any of you helped me. Thank you for your help. F(x)=-3x^2+4x+4G(x)=x(-7x-7)Which expression is equal to f(x)+g(x) You have just won the Georgia Lottery with a jackpot of $17,000,000. Your winnings will be paid to you in 26 equal annual installments with the first payment made immediately. If you had the money now, you could invest it in an account with a quoted annual interest rate of 10% with monthly compounding of interest. What is the present value of the stream of payments you will receive Goods that are partially completed by a manufacturer are a.work in process inventory b.materials inventory c.merchandise inventory d.finished goods inventory