What occurs during the interpretation stage of perception?
a.
our brain tries to categorize the sensory information
b.
our senses are stimulated by things in the world around us
c.
our brain tries to assign meaning to our perceptions
d.
None of the above

Answers

Answer 1

Answer:

In the interpretation stage of perception, we attach meaning to stimuli. Each stimulus or group of stimuli can be interpreted in many different ways. Interpretation refers to the process by which we represent and understand stimuli that affect us.

Explanation:


Related Questions

Your aunt wants to buy a new house. She needs at least two bedrooms and a garage. You are helping her stick to her budget. Muebles $80.000 Casa $470.000 Reparaciones < > $50.000 Casa 1: ‎I sell beautiful property of 175 m‎2‎ in the city. It has three bedrooms, two bathrooms, kitchen with dining room, living room, garage and a small balcony. It needs windows in the bedrooms. The windows cost twenty thousand dollars. He's got all the furniture. ‎ ‎ The price ordered is four hundred thousand dollars. ‎ ‎ 2: ‎ ‎ House of 130 ‎ ‎m‎2‎ on sale. It has a garage, living room and dining room, a bedroom, a bathroom, kitchen and garden. The kitchen needs new cupboards, a stove and a new floor for sixty thousand dollars. It doesn't have a stove. I sell a stove for a thousand dollars with the purchase of the house. ‎ ‎ The price ordered is three hundred and eighty-five thousand dollars. ‎ ‎ 3: Property ‎ ‎ with living room, three bedrooms, kitchen and a ‎ ‎bathroom. It has a small garage and a large patio. There are no flats in the property and the kitchen needs a sink. The kitchen has cupboards. The price for the floors and sink is thirty thousand dollars. ‎ ‎ The price ordered is two hundred and ninety-nine thousand dollars.‎ Based on his budget and needs, which house or houses would be options for your uncle? 1st house 1st and 2nd house 1st and 3rd house 2nd house

Answers

Answer:

- Casa 1.

Explanation:

Casa 1 (house number 1) is the best option because taking into account her budget is the most convenient.  It has three bedrooms, two bathrooms, a combined kitchen and a dining room, and a small balcony. This house needs windows that cost around twenty thousand dollars. A very good thing to take into account is that this house has all the furniture. Finally, the price of this house is four hundred thousand dollars.

पृथिव्यां कति रत्नानि?​

Answers

I don't know what that language is
मलाई थाहा छैन म एक लाख लाग्छ

Haha

Finde Fehler und korrigie
Es shnet und es ist kalt. T
sie eine Schneburg. Sie bl
Sammstag und sie mache​

Answers

Explanation:

Finde Fehler und korrigie

Es shnet und es ist kalt. T

sie eine Schneburg. Sie bl

Sammstag und sie

Choose two or three of the characteristics of successful organizations discussed in this article that you feel are the most important and, using specific examples, explain why you feel that way. (Site 1)

Answers

Answer:

1. first of all they always word a day and night.

2. They do not have gifts for themselves.

3. Honesty and valid.

Answer:

I think effective communication and efficiency are most important. In order to work well as a team, leaders often choose those who excel at certain skills. They need people who are speedy, up-to-the-task. Effective communication is especially important. They need to be able to share opinions and get along with each other. Organizations can't work well without effective communication and efficiency.

Explanation:

Wrote this and got 100%! <3

a low value of the standard error of a measurement indicates?​

Answers

Answer:

A low standard error shows that your sample is representative of your population.

Explanation:

The lower the SEm, the higher the data's reliability.

What is the difference between summertive and formative assessment ​

Answers

Answer:

A summative should be 60% of one's grade. A Formative is 40%

Explanation:

summative assignment are worth a lot more then formative

Correct the mistake in the sentence. The sunlight goes through the raindrops

Answers

Answer:

No period bruv. It's a small but fatal mistake innit mate?

There is absolutely no mistake in this sentence.

You're having difficulty with a college project. Email Kevin, your older brother, explaining the problem, and ask him if he can help when he returns from a business trip this weekend. Use phrasal verbs.​

Answers

The correct answer to this open question is the following.

This is the email.

Hi dear Kevin,

How are you, brother? Hope you are enjoying your trip, although I know is a business trip, it is in a great resort at the beach.

Hey brother, I have a major breakdown here with my project. I think I mess it up. I think my computer has broken down. This is a serious problem and cannot get by with something of bad quality. Tony and I looked up to find a solution, but nothing. I think I need an expert. And you are that expert.

Can you help me? Please. I know that you are going to be tired from your business trip, but this is urgent.

I am going to dive in a little more to explore what the problem can be, but I insist, this is work for a pro.

See you on the weekend, brother!

Segment 1 Collaboration Project

Answers

Answer: What do we do?

Explanation:

Which of the following is an example of using nonverbal communication to accent or complement verbal communication? a. smiling while recounting an experience you found amusing b. clapping after a performance, yelling/cheering during a sporting event c. holding a finger over your mouth to ‘shhh’ someone, nodding your head to say yes d. holding up a hand to indicate you do not wish to be interrupted or to stop communication

Answers

Answer:

Answer is A.

Explanation:

Just took a quiz with the question.

Answer:

a. smiling while recounting an experience you found amusing

Explanation:

edg 2022

A definite area or space where thermodynamic process takes place?

Answers

Thermodynamic system
Other Questions
The boxing world has many famous fights. I will give 3 options of fights that I would like you to research and give me the history of the fight. When it took place, where, who was involved and why it was so significant. In your own words write a paragraph on the fight you choose. Options1) Thrilla in Manila2) Mike Tyson vs. Evander Holyfield3) Rumble in the Jungle A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include Which of the following could be the number shown on the number line? 6Which of these statements is true?Acceleration in the direction of motion slows you downB.Acceleration in the direction of motion speeds you upCAcceleration against the direction of motion has no effecton your speedDAcceleration against the direction of motion speeds you up Interest groups and political action committees are both types of organizations thatwrite and pass laws at the state and local levels.are not part of the government, but can influence thegovernment.hold debates and town hall meetings to inform voterson major election-season issues.raise unlimited money for political campaigns and candidates. "Master", I said "this sayings had for me."This sentence primarily reflects the role ofA. Dante as PilgrimB. Dante as PoetC. Virgil as guideD. Virgil as teacher Suri makes $15 per hour and gets a weekly bonus of $25. Juan makes $14 per hour and gets a weekly bonus of $50. Is it possible for Suri and Juan to makethe same amount of wages, y, by working the same number of hours, x, in one week?O Yes, because the slopes of the equations are different so the system of equations will have one solution.No, because the slopes of the equations are different so the system of equations will have no solutions.O Yes, because the slopes of the equations are the same so the system of equations will have infinitely many solutions.No, because the slopes of the equations are the same so the system of equations will have no solutions. The area of a rectangle is 20 mm2. If the width is 4 mm, find the length? Can I Sign in for free I'm a student so I don't know how to log in please help me I would appreciate your service thank you! can someone help me with this? Whenever energy appears in one system, A. it must have come from somewhere else. B. it means the system is suitable for creating energy. C. it must be used quickly or it will be permanently lost. D. it means energy creation has outpaced energy destruction. Find the value of x pls help with this 8. Find the complete predicate of the sentence below.A boy and his faithful dog are good companions.are good companionsgood companionsa boy and his faithful dogare(and If you scam me ill scam you b!ch can someone turn sweater weather into a sonnet poem Can someone help me please The recipe makes 1 serving of punch. Sam used 2 cups of pineapple juice to make her punch, how many servings did she make? Use the equation 2/3m = 2 to find the number of servings. 2/3 cup = Pineapple juice1/2 cup = orange juice3/4 cup = Lemon/lime juice1/3 cup = Ginger ale 1) The Output of a computer can be seen onb) Mousea) Monitorc) Keyboard Find the surface area of the prism? HELP I need the steps if possible (No linksssssssssssss)Pls help me~English ~Ill mark brainliest if correct What are the mole ratios of the following chemical equation: C3H8 + 5O2 --> 3CO2 + 4H2O?