Which explains how to find the quotient of the division below? -3 1/3 over 4/9

(Please Hurry, I haves time limit)

Answers

Answer 1

Answer:

7 1/2

Step-by-step explanation:

To find the quotient, convert the mixed number to an improper fraction first

Find the quotient now

Simplify

Divide by  both numerator and denominator

Convert to a mixed number


Related Questions

Analyze the diagram below and complete the instructions that follow.
3
3
4
45°
h
x
Find the value of x and the value of y.
A X= 4, y = 8
B. x = 7, y = 42
C. x = 413, y = 7/2
D. -73.7=42

Answers

Answer:

B)   x = 7,   y = 4√2

Step-by-step explanation:

Drop a line from the upper left vertex

This creates a rectangle with a bottom side of 3

and an isosceles right triangle with legs of 4

Therefor

x = 4 + 3

x = 7

y = √(4² + 4²)

y = 4√2

The values of x and y from figure are 7 and 4√2 respectively, option B is correct.

When we analyze the diagram, there is a right angle triangle with opposite side of 4 units.

We have to find the values of x and y.

Sine function is a ratio of opposite side and hypotenuse.

sin45=4/y

1/√2 = 4/y

Apply cross multiplication:

y=4√2.

Now let us find the value of x by cosine function.

Cosine is a ratio of adjacent side and hypotenuse.

cos 45 =x/y

1/√2 = x/4√2

Apply cross multiplication:

x=4

Now from diagram x=4+3 =7

Hence, the values of x and y from figure are 7 and 4√2 respectively.

To learn more on trigonometry click:

https://brainly.com/question/25122835

#SPJ7

Latoya is a software saleswoman. Let represent her total pay (in dollars). Let represent the number of copies of English is Fun she sells. Suppose that and are related by the equation . Answer the questions below. Note that a change can be an increase or a decrease. For an increase, use a positive number. For a decrease, use a negative number. What is the change in Latoya's total pay for each copy of English is Fun she sells

Answers

Answer:

The answer is "$80".

Step-by-step explanation:

Please see the attached file for the whole question.

Yolanda's total pay y changes for each 'English is fun' sold x, i.e.

[tex]\frac{\delta y}{\delta x} = \frac{dy}{dx} \\\\y = 1900+80 x[/tex]

separating the above equation:

[tex]\frac{dy}{dx}= 80[/tex]

Therefore,

[tex]\frac{dy}{dx} = \$80[/tex]

For each 'English is enjoyable' sold x, the change in Yolanda total compensation y is [tex]\$80[/tex].

M and n are both integers. Select all the statements that are true if m and n are also equal to each other.

Answers

The question is incomplete. The complete question is :

M and n are both integers. Select all the statements that are true if m and n are also equal to each other.

A. m - n = n - m

B. 0 = m - n

C. m + (-n) = m - n

D. m + n = 0

Answer :

A. m - n = n - m

B. 0 = m - n

C. m + (-n) = m - n

Explanation :

It is given that m and n are integers and they both are equal to each other.

i.e. m = n

Therefore for option (A),

m - n = n - m

m - m = m - m   (since m and n are equal)

0 = 0

Therefore, the statement (A) is true.

For option (B),

0 = m - n

0 = m - m      (since m and n are equal)

0 = 0

Therefore, the statement (B) is true.

For option (C),

m + (-n) = m - n

m + (-m) = m - m    (since m and n are equal)

m - m = m - m

0 = 0

Therefore, the statement (C) is true.

Now for option (D),

m + n = 0

m + m ≠ 0    (since m and n are equal)

2m ≠ 0

Therefore, the statement (D) is false.

Hence, the options (A), (B) and (C) are true.

WILL GIVE BRANLIEST! pls help thank u sm!! :-) u are all amazing

Answers

Answer:

C

Step-by-step explanation:

Given

3[tex](x+9)^{\frac{3}{4} }[/tex] = 24 ( divide both sides by 3 )

[tex](x+9)^{\frac{3}{4} }[/tex] = 8

Raise both sides to the power of [tex]\frac{4}{3}[/tex]

x + 9 = [tex]8^{\frac{4}{3} }[/tex] = [tex](\sqrt[3]{8}) ^{4}[/tex] = [tex]2^{4}[/tex] = 16 ( subtract 9 from both sides )

x = 7 → C

Please answer the question below

Answers

Answer:

320

Step-by-step explanation:

(2 / 50) * 8000 = 320

Answer:

320

Step-by-step explanation:

If sin x = 1/4
and pi < x < 3pi/2 , find tan x exactly

Answers

Answer:

[tex] \sin(x) = \frac{1}{4} \\ { \sin }^{2} x = \frac{1}{16} \\ { \cos } x = \sqrt{1 - { \sin }^{2}x } \\ \cos(x) = \sqrt{1 - \frac{1}{16} } \\ \cos(x) = \sqrt{ \frac{15}{16} } \\ \tan(x) = \frac{ \sin(x) }{ \cos(x) } \\ \tan(x) = \frac{ \frac{1}{4} }{ \sqrt{ \frac{15}{16} } } \\ \tan(x) = 0.258[/tex]

The exact value of tan x is,

⇒ tan x = - 1/√15

What is mean by Ratio?

A ratio indicates how many times one number contain in another number. The ratio of two number is written as x : y, which is equivalent to x/y.

Where, x and y are individual amount of two quantities.

And, Total quantity gives after combine as x + y.

First, we can use the fact that sin x = 1/4 to find the value of cos x.

We know that;

sin²x + cos²x = 1,

cos²x = 1 - sin²x

cos²x = 1 - (1/4)²

cos²x = 1 - 1/16

cos x = ±√(15/16)

But since we know that x is in the third quadrant , we know that cos x is negative.

Therefore, we can take:

cos x = -√(15/1`6)

Now we can use the fact that;

tan x = sin x / cos x

tan x = sin x / cos x

tan x = (1/4) / (-√(15/16))

tan x = - (1/4) * (4/√15)

tan x = - 1/√15

So, the exact value of tan x is,

⇒ tan x = - 1/√15

Learn more about the ratio visit:

https://brainly.com/question/12024093

#SPJ2

The Thomson family spends money each month on the expenses shown.

Drag each expense to show whether it is a fixed expense, a variable expense, or if it is neither of these from month to month.

Answers

jdnsshsbssnznsns s sis sis s sis is

Let m angle A = 40°. If angle B is a complement of angle A, and angle C is a supplement of angle B, what is m angle B+m angle C? A 60° B. 150° C. 180° D. 210°

Answers

Answer is C)180. Complementary angles are equal so B and A are equal so B=40. Supplanentry angles add up to 180. So B+C=180.

Find the value of x.

Answers

[tex]\huge\bold{Given :}[/tex]

Angle AOD = [tex]x[/tex] - 10°

Angle DOC = 3[tex]x[/tex] + 25°

Angle BOC = [tex]x[/tex] + 5°

[tex]\huge\bold{To\:find :}[/tex]

The value of [tex]x[/tex].

[tex]\large\mathfrak{{\pmb{\underline{\orange{Solution}}{\orange{:}}}}}[/tex]

[tex]\sf\purple{The\:value\:of\:x\:is\:32°}[/tex]

[tex]\large\mathfrak{{\pmb{\underline{\red{Step-by-step\:explanation}}{\orange{:}}}}}[/tex]

We know that,

[tex]\sf\pink{Sum\:of\:angles\:on\:a\:straight\:line\:=\:180°}[/tex]

➪ ∠ AOD + ∠ DOC + ∠ BOC = 180°

➪ [tex]x[/tex] - 10° + 3[tex]x[/tex] + 25° + [tex]x[/tex] + 5° = 180°

Combining like terms, we have

➪ 5[tex]x[/tex] + 20° = 180°

➪ 5[tex]x[/tex] = 180° - 20°

➪ 5[tex]x[/tex] = 160°

➪ [tex]x[/tex] = [tex]\frac{160}{5}[/tex]

➪ [tex]x[/tex] = 32°

Therefore, the value of [tex]x[/tex] is 32°.

Now,

I) AOD = [tex]x[/tex] - 10° = 32° - 10° = 22°

2) DOC = 3[tex]x[/tex] + 25° = 3 x 32° +25° = 96° + 25° = 121°

3) BOC = [tex]x[/tex] + 5° = 32° + 5° = 37°

[tex]\large\mathfrak{{\pmb{\underline{\blue{To\:verify}}{\blue{:}}}}}[/tex]

∠ AOD + ∠ DOC + ∠ BOC = 180°

✒ 22° + 121° + 37° = 180°

✒ 180° = 180°

✒ L. H. S. = R. H. S.

[tex]\boxed{Hence\:verified.}[/tex]

[tex]\huge{\textbf{\textsf{{\orange{My}}{\blue{st}}{\pink{iq}}{\purple{ue}}{\red{35}}{\green{♡}}}}}[/tex]

Help me now please i want to finish this today so I can finish summer school

Answers

same i pass im at like 70% Step-by-step explanation:

A right-angled triangle D E F, angle E marked right angle, side E F labeled 7, side D E labeled 24 and hypotenuse D F labeled 25.

Answers

Answer:

Ya está resuelto ya

Step-by-step explanation:

9. Rachel wants to draw a triangle with
sides of length 4 cm and 5 cm. What is
a possible length of the third side?

Answers

I think its 6 cm for the 3rd side

identify one solution for this graph

Answers

(0,0), (1,1)
Basically, any point that is shaded.

What are the coordinates?

Answers

Answer:

J - (0, 4) K - (2, 3) L - (3, 4) M - (4, 1) N - (1, 2)

Step-by-step explanation:

So, the first number, is the value on the x axis, The second number, is the value on the y axis.

So lets look at each point. J is at 0 on the x axis, and 4 on the y axis.

K is at 2 on the x axis, and 3 on the y axis.

L is at 3 on the x axis, and 4 on the y axis.

M is at 4 on the x axis, and 1 on the y axis.

Finally, n is at 1 on the x axis, and 2 on the y axis.

Since we write coordinates as (x, y):

K is (2, 3)

L is (3, 4)

M is (4, 1)

N is (1, 2)

Hope this helps!

A ping pong ball is released from a height of 60 centimeters (cm) and bounces to a height that is 3/4 the previous height. What function estimates the height, H, in cm of the ping pong ball after x bounces?

Enter a number in each blank to correctly complete the function.

H = BLANK(BLANK)^x

Answers

Answer:

H = 60(3/4)^x

Step-by-step explanation:

After each bounce, the height it reach is 3/4 the previous one.

Let the height of nth bounce be denoted as h_n and the first bounce is h_1.

We are given that h_1 = 60 cm. Following the rule in the problem, we get:

h_2 = (3/4)h_1 = (3/4)60

h_3 = (3/4)h_2 = (3/4)*(3/4)60 = 60(3/4)^2

h_4 = (3/4)h_3 = (3/4)*60(3/4)^2= 60(3/4)^3

We see that h_n = 60(3/4)^n is the formula for the height for the nth bounce. Therefore, H = 60(3/4)^x is the answer.

I hope this helps! :)

What is the sum of 3/10 and 1/3

Answers

Answer:

19/30

Step-by-step explanation:

3/10 + 1/3

Get a common denominator of 30

3/10 * 3/3   + 1/3 * 10/10

9/30  + 10/30

19/30

Answer:

19 / 13

Step-by-step explanation:

➟ 3 / 10 + 1 / 3

➟ 3 / 10 × 3/3 + 1 /3 × 10 /10

➟ 3 × 3 / 10 × 3 + 1 × 10 / 3 × 10

➟ 9 / 30 + 10 / 30

➟ 9 + 10 / 30

➟ 19 / 30


Find three consecutive odd integers where the sum of the first two numbers multiplied by the last number is 3116.

a. -42, -44, - 46
b. None of these.
c. 37, 39, 41
d. 42, 44, 46
e. 33, 35, 37

Answers

B I think cause I tried them all

I will give brainiest

Answers

Answer:

I think is letter B

Step-by-step explanation:

Because I already answer that and my answer is letter B...trust me

What is the constant of the expression:
3n2 +4

Answers

Answer:

the constant is 4 because you always add 4 and it stays 4 no matter what you do to the equation

Step-by-step explanation:

Answer:

It is 4

Step-by-step explanation:

more help srry if its annoying

Answers

Answer:

4^5

4 by the power of 5

Step-by-step explanation:

4 times the amount of 4's

4 times 5 does not equal 4^5 and is not the answer

it is 4 by the power of 5

Help!! YEEEEEEEEEEEEEEEEEET

Answers

Answer:

Step-by-step explanation:

Degree of quadratic equation is 2

So, y = (x + 2)² - 6    ; y = x² - 4x + 2  & y = -(x -2)² + 5  are quadratic equation

(a + b)² = a² + 2ab + b²

y = (x + 2)² - 6

y = x² + 2*x*2 + 2² -6

y= x² + 4x + 4 -6

y= x² + 4x - 2

Degree = 2    

y = -(x - 2)² + 5

y = -[ x² - 2*x*2 + 2²] + 5

y = -[x² - 4x + 4)+5

y = -x² + 4x - 4 + 5

y = -x² + 4x + 1

Degree = 2

Segment & Angle Addition Test

Answers

Hope it is correct!!

the rationalising factor of 3 root + 2 is​

Answers

Answer:

Rationalization factor of √2 + √3 is √2 - √3.

Trust me mark me as brainliest

Write as an equation in two variables: k(x) = -4x-1

Answers

Answer:

y = -4x - 1

Step-by-step explanation:

k(x) = -4x - 1

replace k(x) with y

y = -4x - 1

Answer:

y = -4x - 1

Step-by-step explanation:

What is the value of logb(A^5C^2/D^6)?

Answers

A. There isn't enough information to answer the question.

Hope this helps! :)

Answer:

The answer would be -11

Step-by-step explanation:

You would put each value for each variable, then proceed to graph the logarithm! :)

The equation of the trend line is y = -0.36x + 12.6.
Use the equation of the trend line to predict the wind chill for a wind speed of 49 mi/h. Round your
answer to the nearest degree.
The wind chill at 49 mi/h is
°F.

Answers

Answer:

The answer is -5.04. I didn't get the last part of the question but this is the answer

please help me u guys!!

Answers

We first need to find the circle formula so we take pi(5)^2 and then we get 78.5 which then we times by the height which is 20 - 5 = 15 then the answer is 1177.5 cm^3

9. Find the square root of the following numbers correct to two places of decimal:
a) 0.001
b) 7.01
c) 1.31
with steps pls send
thanks​

Answers

Answer:

a ) 0.03

b) 2.64

c) 1.14

Step-by-step explanation:

Given :

a) 0.001

Now need to find  square root of 0.001

[tex]\sqrt{0.001} =0.03[/tex]

Similarly

b)

[tex]\sqrt{7.01} =2.64[/tex]

c)

[tex]\sqrt{1.31} =1.14[/tex]

Therefore, answer will be :

a ) 0.03

b) 2.64

c) 1.14

Answer: a. 0.03, b. 2.65 c. 1.14

Step-by-step explanation:

You can't find the square root of these manually, so I used a calculator to solve

Any help will be greatly appreciated thanks

Answers

Answer:

2

Step-by-step explanation:

There are 4 x's at 1 mile so he took 4   1 mile hikes

There are 2 x's at 1 1/4 mile so he  took 2  1 1/4 mile hikes

We want to know how many more 1 mile hikes than 1 1/4 mile hikes

4 -2 = 2

Explain how to determine the zeros of f(x)= (x+3)(x-2)(x-6)

Answers

Answer:

The zeros of f(x)  are -3, 2 , 6

Step-by-step explanation:

f(x) is a polynomial of degree 3.

If the polynomial is not factorized we will either factorize to find the zero or use trial and error method.

Since the f(x) in the question is in the factorized form. we will have to equate each factor to zero.

f(x) = (x+3)(x-2)(x-6)

x + 3 = 0 => x = -3

x - 2 = 0 =>  x = 2

x - 6 = 0 => x = 6

Other Questions
Glycolysis takes place in _________________. The cytoplasm The mitochondrial intermembrane space The mitochondrial matrix The endoplasmic reticulum Which sentence correctly uses a comma to join independent clauses? The real numbers whose decimals do not end and do not repeat are (irrational numbers / rational numbers). Answer this guys please I would really appreciate if someone could answer this :) What is the degree of 1 Which detail is most important to include in a summary? Electric current is the flow of ________ through a substance. A shopper is visiting an outdoors market and finds a rug to buy. The shopper does not have a measuring tape to measure the rug. Instead, the shopper takes steps across the rug to determine the dimensions. The shopper's shoes are approximately 12 niches long. What is the estimated area f the rug? Read the excerpt from a report. (1) Stopping trash before it gets to the ocean is way better than having to clean it up in the ocean. (2) The city of Baltimore has a large machine called Mr. Trash Wheel. (3) The machine is powered by the sun and the flow of the river. (4) Floating booms off the front of the machine funnel garbage toward a conveyor belt. (5) The belt takes the garbage from the water and puts it in a dumpster. (6) The trash wheel helps collect garbage in the river after it flows out into the ocean.Which revision improves the professional tone of the text?Change sentence 1 to: Preventing garbage from entering the ocean is more effective than removing waste from the sea.Change sentence 2 to: The city of Baltimore has really cool machine called Mr. Trash Wheel.Change sentence 4 to: Floating booms and a conveyor belt help the machine work its magic.Change sentence 5 to: The belt takes a bunch of the garbage from the water and then tosses it in a dumpster. Please helpExplain two audiences groups that the movie is sustainable for a bank robbery movie? explain in two different paragraphs. 5 to the power -2 * 5x is equal to 1 solve for x If he jumps from the plane with a velocity of +2 ft/s and, after 7 seconds of free fall, he has a velocity of -223ft/s, what is his displacement? Albino Moth - Unknown Allell is listed here. Transcribe it into mRNA andthen translate it into amino acids using the codon table. You only need topost the amino acids. DNA - TGG GGT AAG GAC GAG CGC ATC CAGAGPheUUUUUC)UUAUUGCysUGUUGCUGAUAUUAC)TyUAAStopSerLeuStopUGGTrpUCUUCCUCAUCGCCUCCACCGUAG)CAUTCAC)CUUCUCCUACUGHisLeuProCGUCGCCGACGGArgCAACAG)AAUGinlleSerAUUAUCAUAAUGACUACCACAACGThrAAC) AsnAGUAGC)AGAAGG)Met 13GAUArgGUUGUCValGCUGCCGCAGCGAlaGAC} AspGGUGGCGGAGGGGlyGUAGAAGAGGluGUG If two opposing forces are equal, then the net force is 0 N.true or false? Which is a quadratic function?A y = X-9B y = x +9C y = x + 2x -9 Describe how a jump rope can be used to model a cell membrane of a plant cell what is the value of x to the nearest tenth? NEED HELP!! Edmentum PLATO 50 POINTS! Marketing through social media is very popular today. You have seen how mobile technology has accelerated the use of social media for marketing.Research at least three mobile marketing techniques and then write a report about a company that has used mobile marketing with success. Include the following points in your report: Describe in detail the technique used in the mobile marketing campaign.What was the campaign trying to achieve?Who was the target audience? What techniques did the company use to broaden the audience base?Describe the campaign process in detail.What results did the campaign achieve?How did mobile technology play a key role in the marketing campaign?How did mobile technology enhance the campaign compared to traditional marketing methods?Why do you think the campaign succeeded?In what ways could the company have improved the campaign? What was Darwins conclusion about the shells in Santiago