The answer is D
Explanation:
I apologise for the late answer, but D would be the best one, as it does not discuss morality or anything differing from person to person. The effect it has on birds however, can be readily studied using the scientific method.
Select the correct statement Question 65 options: 1) GPP is the energy spent staying alive 2) GPP is the energy used in cellular respiration 3) GPP is part of NPP 4) NPP is the energy used in growth and reproduction
Answer:
1) GPP is the energy spent staying alive
Explanation:
Gross primary productivity is the energy that is spent by the organism to staying alive because energy is required by the organism for doing activities that is necessary for the survival. Gross primary productivity refers as the rate at which solar energy is captured in sugar molecules during the process of photosynthesis. Producers such as plants use some of this energy for metabolism and cellular respiration as well as some for growth and building tissues.
Help me with this ASAP please I will mark you with Brainliest
Which of the following is not a true statement of the lungs?
Answer: The right lung is shorter and wider than the left lung, and the left lung occupies a smaller volume than the right.
The lung houses structures of both the conducting and respiratory zones.
The left lung consists of three lobes.
The lungs exchange respiratory gases across a very large epithelial surface area—about 70 square meters
Explanation:
Fat cells are expandable. How does this structure relate to a fat cell's function?
A) Fat cells store energy for the body to use later, so being
expandable would help with storage.
B) Fat cells burn energy quickly when other food source is available, so being expandable would help with the rapid burn.
C) Fall cells protect organs, so being expandable can help with cushioning.
D) Fat cells do not expand
Answer:
Explanation:
d
Which two key stellar properties determine all
the other stellar properties?
Answer:
way of seeling and product that he/ she is seeling
The quickest rate at which a population can grow is its ___________________________.
D)
transgenically reduced
12)
The energy required for a seedling to push up out of the ground comes from
A)
muscle tissue.
B)
photosynthesis.
C)
food stored in the seed.
D
other plants
Answer:
In the seed is the energy required for a seedling to push up out of the ground comes from food stored in the seed.
Which is NOT a passive transport mechanism across the membrane of a plant cell?
Which is NOT a passive transport mechanism across the membrane of a plant cell?
Facilitated diffusion
Diffusion
Osmosis
Receptor-mediated endocytosis
Answer:
the company has also announced plans
plants such as the venus flytrap produce chemical compounds that break down insects into substances that are usable by the plant
Answer:
The chemical compounds that break down the insects are most likely BIOLOGICAL CATALYSTS. Venus Flytrap is a kind of carnivorous plant.9
hope it helps
ways to overcome communication barriers.
Answer:
Barriers to communication can be overcome by:
Explanation:
1. Checking whether it is good time and place to communicate with the person
2. Being clear and using language that the person understands
3. Communicating one thing at a time
4. Respecting a person's desire to not communicate
5. Checking that the person has understood you correctly
Answer:
Sent you this for a reference so please do the needful to me ASAP as I am now working on the same and I will be sending the same to you as soon as possible to send the documents to the client to complete the application form for the visa application procedure for visa application procedure so that we may be able to obtain the required necessary documentation information from our legal and professional fees to complete our registration and to return to us to complete the registration process
How does water help drive the rock cycle?
A. It is abundant on Earth's surface.
B. It is an agent of weathering and erosion.
C. It helps Earth maintain a relatively constant temperature.
D. It maintains a liquid state in a relatively narrow range of temperatures
ap3x
Basketball in across a flat floor has blank energy
Answer:
Potential energy. If its laying on a flat floor and not moving, it has the potential to move. if its rolling it has kentic energy bc it wouldnt have the potential, it would be moving. I hope this helps and good luck :)
Explanation:
The incidence of spinal muscular atrophy (an autosomal recessive disease) in the United States is about 1 case in every 17,000. Whereas, in North Dakota, the prevalence is 1 in 6720. Which of the following would support the hypothesis that genetic drift was responsible for the increased allele frequency in North Dakota?
A. There is an abnormally high concentration of mutagenic chemicals in the ground water causing an increased mutation rate in North Dakota.
B. One of the best treatment centers for SMA is located in North Dakota causing migration of SMA carriers into the area at an abnormally high frequency
C. The original settlers of North Dakota were a small group of pioneers who happened to have an abnormally high frequency of the SMA allele in their population.
D. A particular mosquito-born parasite native to North Dakota causes high infant mortality; carriers of the SMA allele are less likely to catch the disease.
Answer:
check this out
Explanation:
A paragraph is a series of related sentences developing a central idea, called the topic. Try to think about paragraphs in terms of thematic unity: a paragraph is a sentence or a group of sentences that supports one central, unified idea.
Genetic drift says it is a random selection of a genetic variant that causing a change in allele frequency in a population.
One of the best treatment centers for Spinal Muscular Atrophy is located in North Dakota causing migration of SMA carriers into the area at an abnormally high frequency. Thus option B is correct.
What is spinal muscular atrophy?It is a group of autosomal recessive inherited disorders cause progressive muscle degeneration and weakness. One of the second leading neuromuscular disease.
Three types of SMA affect only children of less than 1 year and , type IV and Finkel type observed in adult, Symptoms in adult include weakness in muscles, tremor etc.
Type 1 SMA seen during birth symptoms include difficulty breathing and swallowing, Type II show muscle weakness between ages 6 and 12 months, Type III is juvenile type unable to stand and walk.
Type IV causes muscle weakness, tremor and twitching.
Learn more about muscular atrophy, here:
https://brainly.com/question/12993167
#SPJ2
ALL of the following are applicable only
in the United States EXCEPT
A. Clean Water Act
B. Safe Drinking Water Act
C. Marine Protection, Research, and Sanctuaries Act
D. London Convention on the Prevention of Marine
Pollution
Answer:
the answer is C. Marine protection, research and sanctuaries Act.
How does your model support the claim that
the Northern and Southern Hemispheres
have different seasons?
Answer:
Due to presence on opposite side of the globe.
Explanation:
My model support the claim that the Northern and Southern Hemispheres have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.
Los autosomas son aquellos cromosomas que se caracterizan por
Answer:
Los autosomas o cromosomas autosómicos han sido ordenados de acuerdo a la morfología que poseen. ... Cada par de cromosomas son homólogos, es decir, contienen genes idénticos, con la misma ubicación a lo largo de cada cromosoma (locus). Ambos codifican para las mismas características genéticas.
Un autosoma es cualquier de los cromosomas, excepto los cromosomas sexuales. Los humanos tienen 22 pares de autosomas y un par de cromosomas sexuales (el par número 23, formado en las mujeres por dos cromosomas X y, en los hombres, un cromosoma X y un cromosoma Y).
A mother is feeding her infant a cultural dish that contains honey. How do you manage this situation in a culturally sensitive way while considering the safety of her infant?
The situation in which a mother is feeding her infant a cultural dish that contains honey has to be taken with great consideration. This is because it is a matter of the safety of an infant.
What are the steps required for the safety of infants?The steps required for the safety of infants are as follows:
Make a small diet plan for the infant.Do not leave your infant alone on the table, sofa, chair, etc. Always put your baby in a safe place when you are not able to hold him properly.Always follow systematic orders for vaccination.Ensure your child is hydrated all the time.Make possible events to prevent the entry of pathogens.In this situation, you have to acknowledge to the mother that this practice is not safe for the health of your infant and try to introduce some of the negative aspects of this action. Also, warn her not to proceed with this action in the future because child safety is of utmost importance.
Therefore, the situation in which a mother is feeding her infant a cultural dish that contains honey has to be taken with great consideration.
To learn more about the Safety of infants, refer to the link:
https://brainly.com/question/28103752
#SPJ2
If the number of births and deaths in a given time are equal, then the population size will be stable. True or False?
Answer:
True
Explanation:
Because for each death someone is born
It's like 1+1+1-1-1=1
The answer is the same
During a storm, heavy rain ___________ a large rock into smaller pieces and then those pieces are __________ downstream from one place to another. *
erodes / weather
deposits / eroded
weathered / eroded
discharges / deposits
Answer:
1) erodes
2)deposits
Explanation:
Which statement correctly compares mass and weight?
A.Both depend on the force of gravity pulling on an object B.The basic unit of both is the kilogram C.Both mass and weight ofan object would be less on the moon than on Earth D.Weight varies with location, but mass does not vary
Answer:
D. Weight varies with location, but mass does not vary
Explanation:
Weight can be defined as the force acting on a body or an object as a result of gravity.
Mathematically, the weight of an object is given by the formula;
[tex] Weight = mg [/tex]
Where;
m is the mass of the object.g is the acceleration due to gravity.Mass can be defined as a measure of the amount of matter an object or a body comprises of. The standard unit of measurement of the mass of an object or a body is kilograms.
Irrespective of the location of an object or a body at a given moment in time, the mass (amount of matter that they're made up of) is constant. This ultimately implies that, whether you're in the moon, space, earth or any other place, your mass remains the same (constant).
Hence, the statement that correctly compares mass and weight is that, weight varies with location, but mass does not vary. This is simply because acceleration due to gravity changes with location i.e its value varies with the planets.
I’ll Venmo u 5 dollars if u help me. I have a human made for of pollution and natural form of pollution. I have to pick which one is human and natural
Which process is characterized by the movement of particles from an area of high concentration to an area of low concentration across the plasma membrane without the use of energy?
1) hypertonic transport
2) active transport
3) passive transport
4) dynamic equilibrium
Answer:
3) passive transport
Explanation:
Passive transport is a type of cellular transport that does not require the use of energy to move substances (i.e., ions and molecules) across biological membranes. Passive transport uses concentration gradients to move substances across cell membranes, thereby transporting them from regions of high concentration to regions of low concentration. Passive transport can be divided into 1-osmosis (i.e., movement of solvents), 2-diffusion (i.e., movement of solutes), and 3-facilitated diffusion (i.e., movement of molecules with help of protein channels or carriers), and 4-filtration (i.e., movement of water by using a pressure gradient).
Answer: moves particles from on area of low concentration to an area of high concentration
Explanation: Active transport differs from passive transport because active transport
can only move particles into the cell.
does not require energy to transport particles.
moves particles from an area of low concentration to an area of high concentration.
depends on the random movements of particles to carry them across the membrane.
EDG2023
During Meiosis, an important event occurs where the chromosomes that you inherited from your mom exchange pieces with the chromosomes you inherited from your dad. This process is called:
a. Genetic Exchange
b. Recombination
c. Synapsis
d. Crossing Over
Answer:
Hi, there your answer is D.Crossing Over
Hope This Helps
PLZ CORRECT ME IF I AM WRONG :)
Explanation:
please help me with this
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read
Answer:
Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.
Codons before mutation: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
Explanation:
Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.
The Sequence before mutation ATGCTGCGAAACTTTGGCTGA
Codons: ATG CTG CGA AAC TTT GGC TGA
The Sequence after mutation ATGTGCGAAACTTTGGCTGA
Codons: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
why are earth and moon roughly the same age as the rest of the solar system ?
Answer:
Our solar system and everything in it was created at roughly the same time.
Explanation:
The Big Bang theory
The Moon is about 4.51 billion years old – significantly older than previously thought. Previous studies had suggested that it formed about 150 million years after the solar system.
Why is there no change in the moon's surface for billions of years?Eventually, erosion can break a crater down to virtually nothing. The Moon has almost no erosion because it has no atmosphere. That means it has no wind, it has no weather, and it certainly has no plants. Almost nothing can remove marks on its surface once they are made.
How was the Earth and moon formed?The Earth formed over 4.6 billion years ago out of a mixture of dust and gas around the young sun. It grew larger thanks to countless collisions between dust particles, asteroids, and other growing planets, including one last giant impact that threw enough rock, gas, and dust into space to form the moon.
Learn more about solar system here
https://brainly.com/question/1286910
#SPJ2
Which of the following describes the products of mitosis?
two unique cells
one cell identical to the parent
cell death
two daughter cells that have identical DNA to the parent
Answer:
The products of mitosis are two diploid cells, whereas the products of meiosis are four haploid cells. -Mitosis and meiosis both begin with duplicated chromosomes. -In mitosis the daughter cells are genetically identical, but in meiosis the daughter cells are genetically varied.
Explanation:
Describe how the complete oxidation of 1 mole of glucose can generate 32 ATPs. You should include i) products of anaerobic glycolysis with numbers, ii) products of Krebs cycles with numbers, and iii) process of ATP synthesis by electron transport chain via NADH/FADH and H ions
Answer:
Explanation:
1.During glycolysis,four molecules of ATP are formed,and two are expended to cause the initial phosphorylation of glucose to get the process going.This gives a net gain of two molecules of ATP
For every glucose molecule that undergoes cellular respiration, the citric acid cycle is carried out twice; this is because glycolysis (the first stage of aerobic respiration) produces two pyruvate molecules per glucose molecule. During pyruvate oxidation (the second stage of aerobic respiration), each pyruvate molecule is converted into one molecule of acetyl-CoA—the input into the citric acid cycle. Therefore, for every glucose molecule, two acetyl-CoA molecules are produced. Each of the two acetyl-CoA molecules goes once through the citric acid cycle.
The citric acid cycle begins with the fusion of acetyl-CoA and oxaloacetate to form citric acid. For each acetyl-CoA molecule, the products of the citric acid cycle are two carbon dioxide molecules, three NADH molecules, one FADH2 molecule, and one GTP/ATP molecule. Therefore, for every glucose molecule (which generates two acetyl-CoA molecules), the citric acid cycle yields four carbon dioxide molecules, six NADH molecules, two FADH2 molecules, and two GTP/ATP molecules. The citric acid cycle also regenerates oxaloacetate, the molecule that starts the cycle.
While the ATP yield of the citric acid cycle is modest, the generation of coenzymes NADH and FADH2 is critical for ATP production in the final stage of cellular respiration, oxidative phosphorylation. These coenzymes act as electron carriers and donate their electrons to the electron transport chain, ultimately driving the production of most of the ATP produced by cellular respiration.
Whah are the types of kidney?
Answer:
Distinct cell types include: Kidney glomerulus parietal cell. Kidney glomerulus podocyte. Kidney proximal tubule brush border cell.
System: Urinary system and endocrine system
Nerve: Renal plexus
Artery: Renal artery
Vein: Renal vein
Answer:
There are no different types of kidney. We've 2 kidneys - left kidney & right kidney.
The left kidney is longer and narrower than the right kidney. This kidney is in the direction facing the right kidney.Also the left renal volume appears approximately 146 [tex]cm^{3}[/tex] in shape, whereas the right one measures around 134Hope it helps!
╭═══════ღ❦ღ══╮
[tex]RainbowSalt^{2222}[/tex]
╰══ღ❦ღ═══════╯
What is flight initiation distance FID
Answer:
Fight initiation distance (FID) is the distance at which an animal will start to move away from an approaching threat such as a trail user.
hope this helps<3