Answer:
For nutrition and energy
Explanation:
Oxygen has some chemicals that the body transfers into nutrition and energy. Without this your body would not be able to function properly. When we exhale (CO2) that was chemicals the body doesn't want or need.
Hope this helps
If the number of births and deaths in a given time are equal, then the population size will be stable. True or False?
Answer:
True
Explanation:
Because for each death someone is born
It's like 1+1+1-1-1=1
The answer is the same
ALL of the following are applicable only
in the United States EXCEPT
A. Clean Water Act
B. Safe Drinking Water Act
C. Marine Protection, Research, and Sanctuaries Act
D. London Convention on the Prevention of Marine
Pollution
Answer:
the answer is C. Marine protection, research and sanctuaries Act.
A forest fire destroys an area. A small population of trees and a large population of birds are both affected. Which type
of limiting factor causes this?
density dependent
density independent
population dependent
population independent
Answer:
B. DENSITY INDEPENDENT
Explanation:
Density independent is a limiting factor. It affect birth and death rates of organisms through abiotic and environmental factors. A forest fire is one of the environmental factors that affects the density of a species in a given location.
Help me with this ASAP please I will mark you with Brainliest
The incidence of spinal muscular atrophy (an autosomal recessive disease) in the United States is about 1 case in every 17,000. Whereas, in North Dakota, the prevalence is 1 in 6720. Which of the following would support the hypothesis that genetic drift was responsible for the increased allele frequency in North Dakota?
A. There is an abnormally high concentration of mutagenic chemicals in the ground water causing an increased mutation rate in North Dakota.
B. One of the best treatment centers for SMA is located in North Dakota causing migration of SMA carriers into the area at an abnormally high frequency
C. The original settlers of North Dakota were a small group of pioneers who happened to have an abnormally high frequency of the SMA allele in their population.
D. A particular mosquito-born parasite native to North Dakota causes high infant mortality; carriers of the SMA allele are less likely to catch the disease.
Answer:
check this out
Explanation:
A paragraph is a series of related sentences developing a central idea, called the topic. Try to think about paragraphs in terms of thematic unity: a paragraph is a sentence or a group of sentences that supports one central, unified idea.
Genetic drift says it is a random selection of a genetic variant that causing a change in allele frequency in a population.
One of the best treatment centers for Spinal Muscular Atrophy is located in North Dakota causing migration of SMA carriers into the area at an abnormally high frequency. Thus option B is correct.
What is spinal muscular atrophy?It is a group of autosomal recessive inherited disorders cause progressive muscle degeneration and weakness. One of the second leading neuromuscular disease.
Three types of SMA affect only children of less than 1 year and , type IV and Finkel type observed in adult, Symptoms in adult include weakness in muscles, tremor etc.
Type 1 SMA seen during birth symptoms include difficulty breathing and swallowing, Type II show muscle weakness between ages 6 and 12 months, Type III is juvenile type unable to stand and walk.
Type IV causes muscle weakness, tremor and twitching.
Learn more about muscular atrophy, here:
https://brainly.com/question/12993167
#SPJ2
In a photo-tropic experiment, young seedlings in a box were subjected to light from one direction. The seedling continue to grow erect. Which of the following statement is correct
A. Only the tip of the seedling received the light
B. The light was not strong enough
C. The seedlings were rather too young
D. The tip of the seedling may have been covered
E. The box containing the seedling should have been placed on a laboratory bench
Answer: It could be that B, that the light wasn't strong enough
Explanation:
I'm not sure, but the plant didn't grow towards the light, so that's a possible answer I saw
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read
Answer:
Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.
Codons before mutation: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
Explanation:
Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.
The Sequence before mutation ATGCTGCGAAACTTTGGCTGA
Codons: ATG CTG CGA AAC TTT GGC TGA
The Sequence after mutation ATGTGCGAAACTTTGGCTGA
Codons: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
Which of the following is NOT true of fungi?
Select one:
a.
They digest their food outside of the body
b.
They recycle inorganic nutrients to photosynthesizers
c.
Each of the filaments on the body is a mycelium
d.
Fungi cells lack chloroplasts
This is the type of succession that
occurs when all of the usable soil
has been destroyed in an
ecosystem.
A seccession
B primary
C Secondary
C. Secondary Succession
The process of an ecosystem returning to its stable form after a disaster is known as secondary succession.
This happens faster than primary succession because the soil is already formed and nutrients are more available at the beginning of the process.
Hope it helps you! ＼(^ᴥ^)／
Secondary is the type of succession that occurs when all of the usable soil has been destroyed in an ecosystem.
What is a succession?Succession is the process of change and development that occurs in an ecosystem over time. It refers to the gradual replacement of one community of plants and animals with another, as each community modifies the physical and biological environment in which it lives. There are two main types of succession: primary succession and secondary succession.
Primary succession occurs in an ecosystem that has no soil or vegetation, such as on newly formed volcanic islands or in areas where glaciers have retreated. During primary succession, the ecosystem must develop from scratch, with the creation of new soil and the establishment of new plant and animal communities. This process can take a significant amount of time.
Secondary succession occurs when all of the usable soil has been destroyed in an ecosystem. This type of succession can occur after a natural disaster, such as a fire or a flood, or after human activity, such as logging or farming. During secondary succession, the ecosystem must rebuild itself from scratch, with new soil being created and new plant and animal communities establishing themselves. This process can also take a significant amount of time, depending on the severity of the disturbance and the conditions of the ecosystem.
Learn more about succession, here:
https://brainly.com/question/26675203
#SPJ2
Base your answer to questions 8 and 9 on the diagram below and on your knowledge of
biology
The diagram represents a portion of a starch molecule.
8. The energy in this molecule is stored
1. in the bonds between atoms
2. when the carbon atoms break off
3. in the oxygen found in the molecule
4. when water breaks this molecule apart
9. The building blocks for this molecule are
1. amino acid
bases
2. simple sugars
3. Fats
4. molecular
In a starch molecule, the energy is stored in the bonds between atoms, and the building blocks of this molecule are simple sugars.
Starch is a carbohydrate and a polysaccharide, this means this molecule is composed of dozens of glucose molecules that have formed a chain and it is used by organisms, especially plants to store energy.
In other words, starch is the result of glucose molecules forming a chain, and glucose is considered a simple sugar. Therefore, starch is made up of simple sugars.
On the other hand, the energy in starch can be found in the bonds between atoms. This implies once the bonds between atoms break energy is released, and this energy is used by organisms for multiple activities.
Learn more about molecule in: https://brainly.com/question/19922822
Plyometrics can help a person maintain cardiorespiratory fitness true or false
Basketball in across a flat floor has blank energy
Answer:
Potential energy. If its laying on a flat floor and not moving, it has the potential to move. if its rolling it has kentic energy bc it wouldnt have the potential, it would be moving. I hope this helps and good luck :)
Explanation:
Refer to the chart in Figure 10: Effects of Surface Gravity, to see what someone would weigh on different planets.
If you weighed 100 pounds on Earth, you would weigh _______ pounds on Saturn.
94.8
91.6
88.4
120.5
pleas help !!!
Wich is true of Saturns satellite, Titan?
Answer:
Titan's landscape is similar to earth's and show dry rivers and hydrocarbon lakes. it is the only body in the solar system that shows evidence of surface liquid other than earth. It is the only planetary moon in the solar system which has an atmosphere which is rich in nitrogen like earth.
Answer:
it is larger than the planet murcury
Explanation:
Whah are the types of kidney?
Answer:
Distinct cell types include: Kidney glomerulus parietal cell. Kidney glomerulus podocyte. Kidney proximal tubule brush border cell.
System: Urinary system and endocrine system
Nerve: Renal plexus
Artery: Renal artery
Vein: Renal vein
Answer:
There are no different types of kidney. We've 2 kidneys - left kidney & right kidney.
The left kidney is longer and narrower than the right kidney. This kidney is in the direction facing the right kidney.Also the left renal volume appears approximately 146 [tex]cm^{3}[/tex] in shape, whereas the right one measures around 134Hope it helps!
╭═══════ღ❦ღ══╮
[tex]RainbowSalt^{2222}[/tex]
╰══ღ❦ღ═══════╯
I’ll Venmo u 5 dollars if u help me. I have a human made for of pollution and natural form of pollution. I have to pick which one is human and natural
Fat cells are expandable. How does this structure relate to a fat cell's function?
A) Fat cells store energy for the body to use later, so being
expandable would help with storage.
B) Fat cells burn energy quickly when other food source is available, so being expandable would help with the rapid burn.
C) Fall cells protect organs, so being expandable can help with cushioning.
D) Fat cells do not expand
Answer:
Explanation:
d
Ella has a mass of 56 kg, and Tyrone has a mass of 68 kg. Ella is standing at the top of a skateboard ramp that is 1.5 meters tall. Which conclusion is best supported by the given information?
If Tyrone stands at the top of the same ramp, his potential energy will be less than Ella’s.
If Tyrone stands at the top of a 1 m high ramp, his potential energy will be greater than Ella’s.
If Tyrone stands at the top of the same ramp, his potential energy will be the same as Ella’s.
If Tyrone stands at the top of a 2 m high ramp, his potential energy will be greater than Ella’s.
Answer:
d i guess
Explanation:
4. What does the term reflection mean?
Waves pass through an object
Waves change their shape
Waves are absorbed by the object
Waves bounce off an object
Answer:
Waves bounce off an object
Answer:
Waves bounce off an object
please help me with this
How does your model support the claim that
the Northern and Southern Hemispheres
have different seasons?
Answer:
Due to presence on opposite side of the globe.
Explanation:
My model support the claim that the Northern and Southern Hemispheres have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.
What is flight initiation distance FID
Answer:
Fight initiation distance (FID) is the distance at which an animal will start to move away from an approaching threat such as a trail user.
hope this helps<3
Which is a positive effect of wildfires?
Answer: it lets for room for more buildings to be built
Explanation:
How many moles of NaCl are in 200 grams?
Answer:
3.42 moles
Explanation:
Molar mass of NaCl= 58.4 g/mol
Number of moles in 20g of NaCl is
200.0/58.4 = 3.42 moles
The most diverse community would typically found in
Habitat 1
Habitat 2
Habitat 3
Non of the above
Which of the following could occur as the result of runoff of high nitrogen fertilizers from farmlands near a lake?
O an increase in algae growth resulting in low oxygen levels in the lake
O a decrease in mineral storage reducing carbon levels of the lake
O a decrease in pollution in lower ozone levels in the lake area
O an increase in deforestation reducing animal populations in the lake area
Answer: the first one an increase in aldae
Explanation:
The sun is a natural resource used by people. Why is the sun considered a renewable resource? *
the sun goes away at night and then comes back in the morning
on cloudy days, the sun cannot be used
solar energy from the sun is limited
the sun is an unlimited source of energy that isn't used up as fast as people use it
Answer:
Because the earth continuously receives solar energy from the sun, it is considered a renewable resource.
Explanation:
John Needham, Louis Pasteur, and other scientists all performed experiments to disprove ______.
a) spontaneous generation
b) evolution
c) Koch's postulates
d) binomial nomenclature
Answer:
A) spontaneous generation
Explanation:
Spontaneous Generation theory stated that living organisms could be spontaneously generated from non-living matter. Francesco Redi conducted an experiment similar to the one Louis Pasteur would do nearly 200 years later. The 17th-century Italian developed a spontaneous generation experiment that showed that maggots do not spontaneously emerge from decaying meat.
MARK THIS ANSWER BRAINLIEST PLEASE ❤️
The theory of spontaneous generation is an experiment that tries to prove the possibilities that living organisms can be produced from non-living origins.
This experiment was first done by Francesco Redi in 1668. However, several scientists such as John Needham, Louis Pasteur, John Tyndall amongst other scientist tried to disprove the theory of spontaneous generation.
The theory was later disproved by Louis Pasteur and John Tyndall in the mid-19th century.
Read more about spontaneous generation at:
https://brainly.com/question/2003717
what type of food is made during photosynthesis
Answer:
glucose
Explanation:
Plants, unlike animals, can make their own food. They do this using a process called photosynthesis . During photosynthesis, plants produce glucose from simple inorganic molecules - carbon dioxide and water - using light
(bbc)
Select the correct statement Question 65 options: 1) GPP is the energy spent staying alive 2) GPP is the energy used in cellular respiration 3) GPP is part of NPP 4) NPP is the energy used in growth and reproduction
Answer:
1) GPP is the energy spent staying alive
Explanation:
Gross primary productivity is the energy that is spent by the organism to staying alive because energy is required by the organism for doing activities that is necessary for the survival. Gross primary productivity refers as the rate at which solar energy is captured in sugar molecules during the process of photosynthesis. Producers such as plants use some of this energy for metabolism and cellular respiration as well as some for growth and building tissues.
