Write a small paragraph using the idioms given below:-

1. At the drop of a hat - without any hesitation.
2. Hit the nail on the head – say something exactly right.
3. Piece of cake – A task that is easy or simple.
4. Costs an arm and a leg – This idiom is used when something is very expensive.
5. Blessing in disguise – something good that isn’t recognized at first.

Answers

Answer 1

Answer:

The car getting broken turned out to be a blessing in disguise. The reparations could cost an arm and a leg, but I hit the nail on the head when I asked my brother to help me fix it before he left town. He agreed to help at the drop of a hat, and with him, the reparations were not only a piece of cake but also half the budgeted cost.

Explanation:

An idiom is a phrase or a group of words with a meaning that is not inferable from the chosen words but by custom and usage.


Related Questions

economics
civics
culture
geography
artifacts
Put each word into a sentence to show your understanding of the word

Answers

Answer:

Culture is the sum total of the beliefs and way of life of a particular set of people.

Smart economics is a very important factor in any country that wants to be prosperous and make the cost of living for her citizens affordable should imbibe.

The geography of a place includes the physical characteristics and atmosphere of a particular place.

Archaeologists on the site found some articitacts from the pre-historic era.

Civics is the study of the rights, duties and obligations of a citizen.

why has the wax museum been a famous tourist attraction?​

Answers

A wax museum consists of a collection of wax sculptures representing famous people from history and contemporary personalities exhibited in lifelike poses wearing real clothes. That why it is famous for tourist attraction.

Which of the following is likely a contributing factor to the increase of racial
and ethnic diversity in the workforce?

Answers

Probably immigration

The factor that contributes to the increment of racial and ethnic diversity in the workforce is immigration. Thus, option (D) is correct.

What is workforce?

The term workforce can be defined as the total number of individual doing a job in the particular country over a specific period of time. Those individual who are mentally and physically capable to perform the task in the job.

The process of traveling to a new nation or area with the aim of remaining and living there is known as immigration.

People may decide to relocate for a number of reasons, including job possibilities, fleeing a violent conflict, environmental issues, educational chances, or reuniting with family.

Immigration is a component that contributes to the boost in racial and cultural diversity in the workforce. Therefore, it can be concluded that option (D) is correct.

Learn more about immigration here:

https://brainly.com/question/17124402

#SPJ2

Words ending in city
1/ the business of advertising is known as this p..........city
2/ Something that is tenacious (holding firm)has this t..........city
3/ Someone who is eccentric has this quality e.......city
4/ This is just a large or important town c........city
Please answer and I will give you brainliest

Answers

Explanation:

1. publicity

2.tenacity

3.eccentricity

4.central city

I'll give 50 points in the next question I ask I will ask it at 9:45 be ready

Answers

Answer:

ok lol

Explanation:

Answer:

45

Explanation:

Connotation does not refer to:
A. the meaning of a word that changes depending on someone's
experiences.
B. the meaning of a word that changes depending on someone's
culture.
C. the dictionary definition of a word.
D. the feelings and emotions attached to a word.

Answers

Answer:

C. the dictionary definition of a word.

Explanation:

Connotation is not the dictionary definition, that would be denotation, and since the question asks which answer is incorrect, it would be C.

i think it’s C?!!?!!!!

What is the claim in this excerpt?

Answers

Answer:

Option C would be the correct choice.

Explanation:

Relatively poorly recognized have been the modern consumers who staged a defend throughout the Arab world. These same stories of them have been less appreciated. Mostly as a direct consequence, nearby news reporting has dropped. But nobody was curious to learn local news generates that concentrated mostly on widely known defend expects.

The latter alternative options weren’t linked to the sort of situation in question. Therefore this response is the correct one.

Help plz The purpose of concept-mapping is to
a ldentify sequence
b. Identify vocabulary
C. ldentify relationships
d. Identify questions
Please select the best answer from the choices provided
OA
OB
C
D

Answers

Answer:

I believe it's C.

Explanation:

Which word is misspelled?
A.gulfs
B. shelfs
C.beliefs
D.bluffs

Plsss help

Answers

Answer:

The answer to this I'm pretty sure is B shelfs

Explanation:

its should be shelves sorry if it's wrong but I'm sure its right

Answer:

B

Explanation:

I took da test

11. What do you think the prefix IN- means?

Answers

Answer:

The prefix in, which means “in, on, or not,” appears in numerous English vocabulary words, for example: inject, influx, and insane.

means “in” “no” “not”

in your opinion did the speaker actually hear a ghost

Answers

Answer:no

Explanation:

Answer:

no

Explanation:

PLS HELP!!

What are two forms of information useful to research that you will likely find when conducting online searches?
a. statistics and encyclopedias
b. opinion pieces and newscasts
c. articles and music videos
d. newspapers and magazines

Answers

Answer:

a. statistics and encyclopedias

d. newspapers and magazines

Explanation:

They most probably will state facts rather than opinions

Answer:

The answer is b

Explanation:

write 10 words, related to Winter and encircle the vowels​

Answers

Answer: Cold

Explanation:

What is the author’s tone? Provide specific examples from the text to illustrate your response. (list three tones and cite examples)

He is right. We are not youth any longer. We don't want to take the world by storm. We are fleeing. We fly from ourselves. From our life. We were eighteen and had begun to love life and the world; and we had to shoot it to pieces. The first bomb, the first explosion, burst in our hearts. We are cut off from activity, from striving, from progress. We believe in such things no longer, we believe in the war.“ (Remarque 87-88).

Answers

Answer: An author's tone is like the writers attitude going with the story.

Explanation:

Which of the following is a denotation of interesting?
O A. Emotions of excitement
B. Overwhelming feeling
O C. Holding one's attention or provoking interest
O D. Memories of science class experiments

Answers

Answer:

c

Explanation:

it makes the most sense

Imagine you've been assigned a paper on "racism and civil rights." You start with a broad keyword search for "racism and civil rights," which turns up several articles. The one you choose to read refers to a woman by the name of Rosa Parks. You then do a search for "Rosa Parks." What is this process of extracting keywords from larger sources called?

• synthesizing
• brainstorming
• cross-referencing
• peer-reviewing

Answers

Answer:

1

Explanation:

Answer: Cross-Referencing

Explanation:  

cross-referencing : the process of extracting a subject's key concepts from larger sources for the purpose of focusing research

Which of the following was one of the main problems the colonists had with Great Britain asserting rule over the colonies?
Group of answer choices

colonists had no representation in Parliament

colonists were used to ruling themselves

the colonies were bought by Britain from France so the colonists didn't feel loyalty to the British

the colonies were upset that Britain was stopping the practice of slavery

Flag this Question
Question 220 pts
Who was the main author of the Declaration of Independence?
Group of answer choices

Thomas Paine

Thomas Jefferson

James Madison

John Adams

Flag this Question
Question 320 pts
Which of the following is NOT included in the Declaration of Independence?
Group of answer choices

formal declaration

assertion of natural rights

grievances

articles of confederation

Flag this Question
Question 420 pts
"We hold these truths to be self-evident, that all men are created equal, that they are endowed by their Creator with certain unalienable Rights, that among these are Life, Liberty and the pursuit of Happiness."

-excerpt from Declaration of Independence

This excerpt best supports which of the following concepts?

Group of answer choices

separation of powers

natural rights

rule of law

social contract

Flag this Question
Question 520 pts
"That to secure these rights, Governments are instituted among Men, deriving their just powers from the consent of the governed, — That whenever any Form of Government becomes destructive of these ends, it is the Right of the People to alter or to abolish it..."

-excerpt from Declaration of Independence

Group of answer choices

separation of powers

natural rights

rule of law

social contract

Answers

1 the colonists were bought by Britain from France to the colonists and felt like they owe no loyalty to the British 2 Thomas Jefferson 3 grievances 4 rule of law

Answer:

1.   colonists had no representation in Parliament  

2.   Thomas Jefferson  

3.   articles of confederation  

4.   natural rights  

5.   social contract  

Explanation:

someone help me please. ​

Answers

1- simile
explanation: it is relating the person to the feather, both being light, while using LIKE or AS. it is still giving the person its own identity while comparing it.

2- metaphor
explanation: it is immediately calling the girl a rocket ship, without LIKE or AS, meaning it’s relating her to it without giving the girl her own identity.

3- simile
explanation: it is relating the person to a diamond, both being shiny, while using LIKE or AS. it is still giving the person its own identity while comparing it.

4- allusion
explanation: it is indirectly referring the person’s dancing to another identity who dances as well.

5- personification
explanation: it is comparing the parking place to something non-human, as a way to express the person’s feelings about it more.

Why do you think a tour done by street kids themselves could be more effective than a more traditional tourist attraction?
(Whoever has best answer gets brainlest bc i need this answer asap) <3

Answers

Answer:

becuase kids are more creative than adultas and have more open minds. They have an imagination that is more unique and imaginitive than older people like adults.

Explanation:

Street kids are the ones who probably know the town the best. They run around and know the ins and outs of everything there is to know, when tourists just show you things anyone could find - the obvious things. It would probably be a lot more interesting to have a tour done by someone who lives and explores the streets everyday.

Connotation does not refer to:
A. the meaning of a word that changes depending on someone's
experiences.
B. the meaning of a word that changes depending on someone's
culture.
C. the dictionary definition of a word.
O D. the feelings and emotions attached to a word.

Answers

i think it’s D!!!!!!

Connotation does not refer to the dictionary definition of a word. Option C is correct.



Connotation refers to the feelings and emotions that are associated with a word (D). It goes beyond the literal or denotative meaning of a word and includes the subjective or cultural meanings that people attribute to it.

For example, the word "home" may have a positive connotation for some people, representing a place of comfort and security. However, for others who have had negative experiences at home, it may have a negative connotation.

Connotation can also vary depending on someone's experiences (A) and culture (B). Different individuals or groups may interpret words differently based on their personal or cultural backgrounds.

To summarize, connotation is about the emotional or cultural associations that people have with a word, not the dictionary definition.

To know more about dictionary:

https://brainly.com/question/1199071

#SPJ4

what did aristotle believe are the three forms of hapiness?

Answers

Answer:

Aristotle believed in 3 forms of happiness, the first form is life of pleasure and enjoyment. The second form of happiness is a  life as a free and responsible citizen. The last form of happiness is is a life as thinker and philosopher.

Explanation:

_____ can also be thought of as an appeal to the most basic values held by your audience.

1. Arguments

2. Logos

3. Pathos

4. Reasons

Answers

I think it’s answer A

Choose the best paraphrase for each line in this quatrain.

Line 1:

Line 2:

Line 3:

Line 4:

Answers

Answer:

1- Ive seen roses streaked with red and white

2-but i dont see those colors in her cheeks

3-and some perfumes have a sweeter scent

4-than the bad breath of my mistress

Explanation:

35. Identify the term that best describes the italicized words.
(1 point)
Meteors, often called shooting stars, can be seen on almost any cloudless night.
O appositive phrase
O participial phrase
O gerund phrase
O infinitive phrase

Answers

Answer:

gerrund phrase

Explanation:

The term that best describes italicized words is the gerund phrase. The correct option is c.

What is a gerund?

The noun form of a verb with the ending -ing is known as a gerund. Taking play, dancing, and eating as examples. Students immediately find this confusing because they are accustomed to thinking of that form as the continuous/progressive form of the verb.

A gerund phrase is a collection of words that includes the gerund and any relevant modifiers or objects. A gerund phrase can be used as a noun as well. The statement that makes use of a gerund phrase is among the possibilities.

The dog was punished for chewing on the slipper. You can be certain that this was the proper choice because the dog was penalized for the entire incident of "chewing on the slipper."

Therefore, the correct option is c,  gerund phrase.

To learn more about gerund phrases, refer to the link:

https://brainly.com/question/11017355

#SPJ2

COME HELP ME HERE ONLY IF YOU KNOW THE ANSWER.


At the end of "The Gift of the Magi," Jim says that he and Della should forget their gifts for a while and eat supper. This suggests the theme that love is

understanding.
romantic.
easily lost.
being together.

Answers

Answer:

understanding.

At the end of "The Gift of the Magi," Jim says that he and Della should forget their gifts for a while and eat supper. This suggests the theme that love is understanding. Hence, option A is appropriate.

What is "The Gift of the Magi"?

O. Henry's short story "The Gift of the Magi" was first released in 1905. The tale centers on a young spouse and husband who must find inexpensive ways to buy Christmas presents for each other in secret.

O. Henry's short story "The Gift of the Magi" depicts the story of a young couple who wishes to offer each other special Christmas gifts. Due to their limited resources, the couple must each give up something they value in order to purchase a gift for each other.

Love, according to "The Gift of the Magi," is more significant than outward appearances. Each character in this short novella forfeits what they value most. Jim gives away his watch, giving the impression that he is an important person.

Hence, option A is correct.

Learn more about "The Gift of the Magi" here:

https://brainly.com/question/29792170

#SPJ6

CAN you explain and answer it​

Answers

Answer: C

Explanation:

Write one sentence on why it is important to not plagiarize.

Answers

Answer:

It’s stealing and lying. Stealing and lying are wrong, remember? Stealing someone else’s words and putting your own name on these words is wrong.

Explanation:

Question 1 of 10
Read the following lines from "Wash of Cold River" by H. D.:
rare, pure of texture
beautiful space and line,
marble to grace
your inaccessible shrine.
How do these lines show elements of formal verse?
O A. They show a clear pattern of end rhyme.
O B. They have the same number of syllables.
O C. They follow a structure similar to a ballad.
O D. They are written in strict iambic pentameter.

Answers

Answer:

apple

Explanation:

The lines of the poem show the end rhymic structure where the last words end with a rhyme.

What do you mean by the end rhyme pattern of poem?

End rhyme patterns of the poem where the ending words of the poem sound similar in rhymic tone. This kind of rhyme helps the reader to remember the poetry for a  long time.

This poem states the natural beauty of the earth and compares it with feminism through different adjectives.

Therefore, in this poem both the lines are ends with similar sounds like "line" and "shrine" which shows the end rhyme pattern.

Learn more about the end rhyme pattern, here:

https://brainly.com/question/14694356

#SPJ2

I need help now please ​

Answers

Answer:

With what? I can help.

what would you like help with??

PLEASE HELP ME FAST I NEED HELP

Answers

Answer:

another character hope this helped

Explanation:

because usally conflicts happen between two people

Answer:

fear

Explanation:

internal conflict is man vs. self

Other Questions
can you please help me:) At a sleepover, three friends ate of a pizza. For a snack the next day, the friends3 of the leftover pizza. What fraction of the pizza was not eaten?ate A Material Safety Data Sheet (MSDS) is a document that provides information about how to handle and safely dispose ofhazardous chemicals.sharps.infected body tissue.surgical equipment. Change the following sentence into passive form1. What question did they raise in the discussion?2. They are going to build that bridge in 20183. They used to build houses of wood 4. How many trees can we save for every ton of recycled newsprint ?5. We can make many things from wood 6. If I were you. I wouldnt accept his invitation 7. They must do it before I come 8. Where do they keep a large collection of books?9. They can find the books they want in the library 10. What do they keep a large collection of the books for ?Thank you very much What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... What are the outcomes of the ice cap melting? Choose all that apply.1. Light cannot be reflected back to the atmosphere2. Sea level rises3. Absorption of solar radiation leads to increase in ocean temperature4. Ocean remains unaffected paid rent of Rs.25000 by cheque. make journal entry m2 = by the .m1 = by the .m3 = by the . please help me with thisanswer choiceThis system has infinitely many solutions.This system has exactly one solution.This system has no solution.(5, 28) and (0, 0) please answer correctly no trolls! Gregory knows that Triangle A B C is reflected onto Triangle A prime B prime C prime. Which statement about the figures is true?If Gregory draws the segment with endpoints A and A, then the midpoint will lie on the line of reflection.If Gregory draws the segment with endpoints B and C, then the midpoint will be on the line of reflection.Points A and B are equidistant from the line of reflection.Line segment A B will be perpendicular to the line of reflection. Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! Three hundred cars drove over a bridge in 23 minutes. At that rate, howmany cars would drive over the bridge in 138 minutes? Rule-of-thumb budgeting is budgeting that's popular with the hospitality and tourism industry because it's so effective. trueorfalse can someone please answer these and explain how you did it2x - 7 = 117x + 1 = 223x - 8 = 228x +5 = 45 write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC A store receives customer satisfaction ratings that range between 0 and 100. In the first 13 ratings the store received, the average customer satisfaction rating was 75. What is the least value the store can receive for the 14th rating and still be able to have an average of at least 84 for the first 21 ratings? What is the main purpose of foreign aid? Help plz... give you brainliest for who ever answers, plz need help.