Answers
Answer:
P1 = GGBB ( purple stem with green leaves )
P2 = GGyy ( purple stem with yellow leaves )
Explanation:
Determine the two most likely genotypes of the P ( P1 and P2 ) generation
From table :
purple stem with green leaves occurs 90% ( dominant trait )
Green stem with green leaves occurs 30% ( recessive trait )
let : G = purple stem , g = green stem , B = green leaves, y = yellow leaves
Hence the two most likely genotypes of P1 and P2 are :
P1 = Purple stem with green leaves – GGBB (P-90%, F1-60%) ( from table attached below )
P2 = Purple stem with yellow leaves – GGyy (P-10%, F1-10%) ( from table attached below )
Related Questions
Name the main hormone that causes the tropic response movement of pollen tubes towards ovule.
Answers
Answer:
Chemotropism
Explanation:
Differences among individuals of the same species are known as:
Different offsprings, from the same parents.
A.Natural Selection
B.Adaptations
C.Variations
D.Fittness
Answers
Answer:
variation is the answer that is genetic variation
Which of the following is not a true statement of the lungs?
Answers
Answer: The right lung is shorter and wider than the left lung, and the left lung occupies a smaller volume than the right.
The lung houses structures of both the conducting and respiratory zones.
The left lung consists of three lobes.
The lungs exchange respiratory gases across a very large epithelial surface area—about 70 square meters
Explanation:
How does your model support the claim that
the Northern and Southern Hemispheres
have different seasons?
Answers
Answer:
Due to presence on opposite side of the globe.
Explanation:
My model support the claim that the Northern and Southern Hemispheres have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.
Which two key stellar properties determine all
the other stellar properties?
Answers
Answer:
way of seeling and product that he/ she is seeling
Which statement correctly compares mass and weight?
A.Both depend on the force of gravity pulling on an object B.The basic unit of both is the kilogram C.Both mass and weight ofan object would be less on the moon than on Earth D.Weight varies with location, but mass does not vary
Answers
Answer:
D. Weight varies with location, but mass does not vary
Explanation:
Weight can be defined as the force acting on a body or an object as a result of gravity.
Mathematically, the weight of an object is given by the formula;
[tex] Weight = mg [/tex]
Where;
m is the mass of the object.g is the acceleration due to gravity.Mass can be defined as a measure of the amount of matter an object or a body comprises of. The standard unit of measurement of the mass of an object or a body is kilograms.
Irrespective of the location of an object or a body at a given moment in time, the mass (amount of matter that they're made up of) is constant. This ultimately implies that, whether you're in the moon, space, earth or any other place, your mass remains the same (constant).
Hence, the statement that correctly compares mass and weight is that, weight varies with location, but mass does not vary. This is simply because acceleration due to gravity changes with location i.e its value varies with the planets.
Which is NOT a passive transport mechanism across the membrane of a plant cell?
Which is NOT a passive transport mechanism across the membrane of a plant cell?
Facilitated diffusion
Diffusion
Osmosis
Receptor-mediated endocytosis
Answers
Answer:
the company has also announced plans
How does water help drive the rock cycle?
A. It is abundant on Earth's surface.
B. It is an agent of weathering and erosion.
C. It helps Earth maintain a relatively constant temperature.
D. It maintains a liquid state in a relatively narrow range of temperatures
ap3x
Answers
During Meiosis, an important event occurs where the chromosomes that you inherited from your mom exchange pieces with the chromosomes you inherited from your dad. This process is called:
a. Genetic Exchange
b. Recombination
c. Synapsis
d. Crossing Over
Answers
Answer:
Hi, there your answer is D.Crossing Over
Hope This Helps
PLZ CORRECT ME IF I AM WRONG :)
Explanation:
Which process is characterized by the movement of particles from an area of high concentration to an area of low concentration across the plasma membrane without the use of energy?
1) hypertonic transport
2) active transport
3) passive transport
4) dynamic equilibrium
Answers
Answer:
3) passive transport
Explanation:
Passive transport is a type of cellular transport that does not require the use of energy to move substances (i.e., ions and molecules) across biological membranes. Passive transport uses concentration gradients to move substances across cell membranes, thereby transporting them from regions of high concentration to regions of low concentration. Passive transport can be divided into 1-osmosis (i.e., movement of solvents), 2-diffusion (i.e., movement of solutes), and 3-facilitated diffusion (i.e., movement of molecules with help of protein channels or carriers), and 4-filtration (i.e., movement of water by using a pressure gradient).
Answer: moves particles from on area of low concentration to an area of high concentration
Explanation: Active transport differs from passive transport because active transport
can only move particles into the cell.
does not require energy to transport particles.
moves particles from an area of low concentration to an area of high concentration.
depends on the random movements of particles to carry them across the membrane.
EDG2023
The order of amino acids in a protein does not matter
Answers
Answer:Amino acids, often referred to as the building blocks of proteins, are compounds that play many critical roles in your body. They're needed for vital processes like the building of proteins and synthesis of hormones and neurotransmitters.
Explanation:
1. Indicate patient history details that are consistent with the patient having an infection. How do the patient’s signs and symptoms compare to a healthy individual?
2. Indicate what you suspect might be the etiological agent. What additional history would you like to have?
3. Based on the microbe you suspect is responsible for the symptoms, from which body sites would you recommend taking culture?
4. . Give culture and test characteristics of the microbe you suspect might be causing the disease. If you suspect more than one might be responsible, how might you distinguish the two?
5. Indicate virulence factors possessed by this microbe that might be responsible for the symptoms. Indicate how it produces the symptoms you observe in the patient.
6. Is this microbe normal microbiota at the culture site?
7. What type of treatment would be used for this patient
Answers
Answer:
All the answers are there in the photo
plants such as the venus flytrap produce chemical compounds that break down insects into substances that are usable by the plant
Answers
Answer:
The chemical compounds that break down the insects are most likely BIOLOGICAL CATALYSTS. Venus Flytrap is a kind of carnivorous plant.9
hope it helps
ways to overcome communication barriers.
Answers
Answer:
Barriers to communication can be overcome by:
Explanation:
1. Checking whether it is good time and place to communicate with the person
2. Being clear and using language that the person understands
3. Communicating one thing at a time
4. Respecting a person's desire to not communicate
5. Checking that the person has understood you correctly
Answer:
Sent you this for a reference so please do the needful to me ASAP as I am now working on the same and I will be sending the same to you as soon as possible to send the documents to the client to complete the application form for the visa application procedure for visa application procedure so that we may be able to obtain the required necessary documentation information from our legal and professional fees to complete our registration and to return to us to complete the registration process
Which statement about the members of a population that live long enough to reproduce is consistent with natural selection?
A.They transmit characteristics aquired by use and disuse to their offspring
B.They tend to produce fewer offspring than others in the population
C.They are the ones that are best adapted to survive in their environment
D.They will perpetuate unfavorable changes in the species.
Answers
Answer:
It's option B
Explanation:
Organisms which can't survive harsh times and have a small lifespan make huge amount of offsprings like ants. While long living animals make fewer offsprings like humans, whales, tortoises.
an individual belonging to blood group A, one of whose parents was Type O, was married to an individual belonging to group AB. What would be the expected results of their offspring with blood type AB? What is the chance that any of their children would be typed A?
Answers
XA XB
XA XAXA XAXB
Y XAY XBY
25% chance the babies have blood type AB and a 50% chance the babies would have blood type A.
hope this helps!!!
The quickest rate at which a population can grow is its ___________________________.
Answers
an example of is a leaking gasoline. tank
Answers
Answer:
When this happens, gas may leak from the vehicle, having an effect on fuel economy, and potentially leading to a dangerous fire or explosion. If gasoline is leaking from the gas tank, you should be able to notice the leak underneath the rear of the vehicle accompanied by a noticeable smell.So that obviously has tank or cylinder is a leaking gasoline.
Explanation:
mark me as brainliest if it helped you >•<
During a storm, heavy rain ___________ a large rock into smaller pieces and then those pieces are __________ downstream from one place to another. *
erodes / weather
deposits / eroded
weathered / eroded
discharges / deposits
Answers
Answer:
1) erodes
2)deposits
Explanation:
Describe how the complete oxidation of 1 mole of glucose can generate 32 ATPs. You should include i) products of anaerobic glycolysis with numbers, ii) products of Krebs cycles with numbers, and iii) process of ATP synthesis by electron transport chain via NADH/FADH and H ions
Answers
Answer:
Explanation:
1.During glycolysis,four molecules of ATP are formed,and two are expended to cause the initial phosphorylation of glucose to get the process going.This gives a net gain of two molecules of ATP
For every glucose molecule that undergoes cellular respiration, the citric acid cycle is carried out twice; this is because glycolysis (the first stage of aerobic respiration) produces two pyruvate molecules per glucose molecule. During pyruvate oxidation (the second stage of aerobic respiration), each pyruvate molecule is converted into one molecule of acetyl-CoA—the input into the citric acid cycle. Therefore, for every glucose molecule, two acetyl-CoA molecules are produced. Each of the two acetyl-CoA molecules goes once through the citric acid cycle.
The citric acid cycle begins with the fusion of acetyl-CoA and oxaloacetate to form citric acid. For each acetyl-CoA molecule, the products of the citric acid cycle are two carbon dioxide molecules, three NADH molecules, one FADH2 molecule, and one GTP/ATP molecule. Therefore, for every glucose molecule (which generates two acetyl-CoA molecules), the citric acid cycle yields four carbon dioxide molecules, six NADH molecules, two FADH2 molecules, and two GTP/ATP molecules. The citric acid cycle also regenerates oxaloacetate, the molecule that starts the cycle.
While the ATP yield of the citric acid cycle is modest, the generation of coenzymes NADH and FADH2 is critical for ATP production in the final stage of cellular respiration, oxidative phosphorylation. These coenzymes act as electron carriers and donate their electrons to the electron transport chain, ultimately driving the production of most of the ATP produced by cellular respiration.
a note on Diversity among protoctista (10 to 12 lines)
Answers
Answer:
Protists are a diverse collection of organisms. While exceptions exist, they are primarily microscopic and unicellular, or made up of a single cell. The cells of protists are highly organized with a nucleus and specialized cellular machinery called organelles.
Kingdom Protista is said to be the most diverse kingdom, because each of its members are so individual from each other. If an organism does not belong any particular kingdom, it goes into kingdom Protista. ... This miscellanous grouping causes the organisms in the kingdom to be very different from each other.
Explanation:
Hope this helps
Genes A and B are on the same chromosome. The genes have alleles A and B on one homologous chromosome, and the alleles a and b on its paired homolog. How could an individual with this allele arrangement produce a gamete with a chromosome containing the alleles Ab or aB?
Answers
Answer:
Through the process of crossing-over
Explanation:
During prophase 1 of meiosis, each chromosome carefully pairs with its homologous chromosome. Homologous chromosomes aline together to make the crossing-over possible, the stage where they interchange their parts.
Crossing-over occurs between two homologous chromosomes in the equatorial plane, making the daughter cells genetically different from the original one.
The point where two chromatids interchange their genetic information is the chiasma, where new genetic material or information is produced to be inherited by descendants. Chiasma allows the crossing-over between two homologous chromatids, one of each parent.
The Crossing-over frequency between two genes depends on the distance between them. A short distance between genes is a small target for crossing-over to occur, which means that only a few of them will happen, compared with the number of events between genes that are more separated from each other.
In the exposed example, the chiasma must be placed between A and B genes.
Before crossing-over
homologous chromosome 1 --------A------*-----B---------homologous chromosome 2 --------a------*------b--------The symbol * represents the area where the chiasma places and crossing-over occurs.
After csossing-over
chromosome 1 --------A------*-----b--------chromosome 2 --------a------*-----B--------D)
transgenically reduced
12)
The energy required for a seedling to push up out of the ground comes from
A)
muscle tissue.
B)
photosynthesis.
C)
food stored in the seed.
D
other plants
Answers
Answer:
In the seed is the energy required for a seedling to push up out of the ground comes from food stored in the seed.
Los autosomas son aquellos cromosomas que se caracterizan por
Answers
Answer:
Los autosomas o cromosomas autosómicos han sido ordenados de acuerdo a la morfología que poseen. ... Cada par de cromosomas son homólogos, es decir, contienen genes idénticos, con la misma ubicación a lo largo de cada cromosoma (locus). Ambos codifican para las mismas características genéticas.
Un autosoma es cualquier de los cromosomas, excepto los cromosomas sexuales. Los humanos tienen 22 pares de autosomas y un par de cromosomas sexuales (el par número 23, formado en las mujeres por dos cromosomas X y, en los hombres, un cromosoma X y un cromosoma Y).
Which of the following describes the products of mitosis?
two unique cells
one cell identical to the parent
cell death
two daughter cells that have identical DNA to the parent
Answers
Answer:
The products of mitosis are two diploid cells, whereas the products of meiosis are four haploid cells. -Mitosis and meiosis both begin with duplicated chromosomes. -In mitosis the daughter cells are genetically identical, but in meiosis the daughter cells are genetically varied.
Explanation:
Is there anything we as a society can do to prevent these pandemic from occurring
Answers
The only thing you can do now is to try do the necessary pre-causion, which are;
Always wear maskAlways be sanitizedAlways wear hand glovesKeep social distancingALL of the following are applicable only
in the United States EXCEPT
A. Clean Water Act
B. Safe Drinking Water Act
C. Marine Protection, Research, and Sanctuaries Act
D. London Convention on the Prevention of Marine
Pollution
Answers
Answer:
the answer is C. Marine protection, research and sanctuaries Act.
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read
Answers
Answer:
Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.
Codons before mutation: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
Explanation:
Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.
The Sequence before mutation ATGCTGCGAAACTTTGGCTGA
Codons: ATG CTG CGA AAC TTT GGC TGA
The Sequence after mutation ATGTGCGAAACTTTGGCTGA
Codons: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
why are earth and moon roughly the same age as the rest of the solar system ?
Answers
Answer:
Our solar system and everything in it was created at roughly the same time.
Explanation:
The Big Bang theory
The Moon is about 4.51 billion years old – significantly older than previously thought. Previous studies had suggested that it formed about 150 million years after the solar system.
Why is there no change in the moon's surface for billions of years?Eventually, erosion can break a crater down to virtually nothing. The Moon has almost no erosion because it has no atmosphere. That means it has no wind, it has no weather, and it certainly has no plants. Almost nothing can remove marks on its surface once they are made.
How was the Earth and moon formed?The Earth formed over 4.6 billion years ago out of a mixture of dust and gas around the young sun. It grew larger thanks to countless collisions between dust particles, asteroids, and other growing planets, including one last giant impact that threw enough rock, gas, and dust into space to form the moon.
Learn more about solar system here
https://brainly.com/question/1286910
#SPJ2
Select the correct statement Question 65 options: 1) GPP is the energy spent staying alive 2) GPP is the energy used in cellular respiration 3) GPP is part of NPP 4) NPP is the energy used in growth and reproduction
Answers
Answer:
1) GPP is the energy spent staying alive
Explanation:
Gross primary productivity is the energy that is spent by the organism to staying alive because energy is required by the organism for doing activities that is necessary for the survival. Gross primary productivity refers as the rate at which solar energy is captured in sugar molecules during the process of photosynthesis. Producers such as plants use some of this energy for metabolism and cellular respiration as well as some for growth and building tissues.
