3. Calcium carbonate is the majour component of marble. Sulphuric acid one of the majour components of acid rain. Write a balanced chemical quation to show how the corrosion of marble statue by the acid rain.

Answers

Answer 1

Answer:

here

Explanation:

CaCO3 + H2SO4

-----> CaSO4 + H2O + CO2


Related Questions

A recent viral video entitled "How Wolves Change Rivers" argues that the reintroduction of wolves to Yellowstone after a 70 year absence led to multiple changes in the biodiversity and ecology of the park. This is an example of a(n)

Answers

The options are missing from the question,below are the missing options;

a. Trophic cascade

b. Primary succession

c. Autograph

d. Eutrophication

e. Pioneer community

The correct answer to the question is option A.

TROPHIC CASCADE.

Trophic Cascade occurs when there is a series of significant difference/changes in the population size of organisms in the tropic level of an ecosystem.this change in trophic level occurs in a food chain and as a result of predators being in high trophic levels, they use the opportunity to indirectly promote the population of the organisms in the low trophic levels,they do so by ensuring that species that are at intermediate trophic levels are are in close watch or check.

This corresponds with the viral video of of how wolves change rivers featuring

the reintroductionn of wolves to Yellowstone after a 70 year absence which led to multiple changes in the biodiversity and ecology of the park.

Watch the video “Teen Stress.” Now, imagine that a friend confides in you that he is going to the doctor because he feels that stress might be affecting his blood pressure. He wants you to help him develop a list of questions to ask the doctor. Come up with five questions for your friend to ask about stress and blood pressure.

Answers

Answer:

questions:

Should I or can I eat salty foods?

Do I have to check my pressure immediately?

Do I have to follow a balanced diet?

Is it good to do physical activity?

Do I have to worry about the signs of eye flickering and headache?

Explanation:

Blood pressure is regulated by endogenous mechanisms, although these sometimes fail and it is necessary to take drugs to reduce high blood pressure, an example of which is beta-blockers.

Blood pressure is also regulated by diets based on low sodium consumption, necessary calories and with great contributions of nutrients since cardiac or cardiovascular health is also essential in the face of possible formation of atheroma plaques.

The increase in blood pressure with the appearance of atheroma plaques is very common, and it is also the two most frequent causes of AMI (acute myocardial infarction)

Answer:

1)How much does blood pressure rise because of stress?

2)Are there techniques that I can use to cope with stress?

3)Do these techniques help to reduce blood pressure?

4)Is exercise helpful in reducing blood pressure caused by stress?

5)Would medication help my condition?

6)Are there any other risk factors for high blood pressure?

Explanation:

Answer from plato.

what are top consumer​

Answers

Answer:

it is a food chain.

I can't write more it's not allowed

Humans are at the top of the food chain which makes up primary consumers

Explain Fo- F1 pump in mitochondria?
Please
I will mark you the brainlest ​

Answers

mitrochondrial Proton FOF1 ATPase / ATP synthase synthesis ATB during oxidative phosphorylation. In this study, we examined of effects of several groups of polyphenolic photochemicals on the activity of the enzyme

Answer:

ATP sinus is enzyme that creates the energy storage molecules adenosine triphosphate ADP and inorganic phosphate the overall reaction catalysed by ATP synthesis is

ADP+Pi+3H+out =ATP+H2O+3H+in

John and Joshua used a light microscope to observe a plant cell. They indicated the magnification as x1000. Given the eye piece lens magnification x10. Work out the objective lens magnification.

Answers

Answer:

Objective Lens Magnification = ×100

Explanation:

In a microscope, the ocular (eyepiece) lenses are usually to a magnification of ×10, meaning that it magnifies the image 10 times. While the standard objective lenses have magnifications of ×4, ×10, ×40, and ×100.

In order to work out the total magnification, the individual magnifications of the ocular and objective lenses have to be known, after which a simple multiplication of both magnifications will give the total magnification used.

Total Magnification = (eyepiece lens magnification) × (objective lens magnification)

1000 = 10 × obejcetive lens magnification

Dividing both sides by 10

Objective lens magnification = 1000 ÷ 10 = 10

∴ Objective lens magnification = ×100

ANP is a hormone that causes:_________ a. constriction of the afferent arterioles and inhibition of renin release. b. dilation of the afferent arterioles and inhibition of renin release. c. dilation of the afferent arterioles and release of renin. d. constriction of the afferent arterioles and release of renin.

Answers

Answer:

b. dilation of the afferent arterioles and inhibition of renin release.

Explanation:

Atrial Natiuretic Peptide is a hormone which is mainly made and secreted in the atria. It helps in the regulation of blood pressure levels with the use of the kidney through an increase in water and sodium excretion.

The hormone helps in the regulation of blood pressure by ensuring there are dilation of the afferent arterioles to give room for increased flow of blood due to the increased pressure. Study also shows that the enzyme inhibits the release of renin.

Arctic sea ice has declined over the past few decades causing water levels to increase. This is an interaction of which two spheres?

Answers

Answer:

Cryosphere and Hydrosphere

Explanation:

The Cryosphere refers to the frozen water bodies on earth. This includes glaciers, icebergs, ice sheets and frozen water surrounding the Arctic and Antarctica.

The Hydrosphere refers to all the water bodies on Earth, including rivers, streams, lakes, and ponds.

Answer:

Cryosphere and Hydrosphere

Explanation:

YOUR WELCOME

The notion that the traits that help a species survive and reproduce are passed along more frequently than those that do not (i.e. differential reproduction and adaptation) is known as

Answers

Answer:

Natural selection

Explanation:

According to  Darwin's theory, natural selection is the process by which individuals better adapted to their environments have more chances to survive and reproduce, and thereby their descendants will be better represented in the next generation. This mechanism exploits the existence of natural variation among members in the population which is used to select those individuals that are better adapted (i.e., with a higher adaptive fitness) for their environments. Natural selection is a key mechanism of evolution by which species change across time.

Compare the characteristics of nitrogen fertilisers that are used for
broadcasting with a phosphate fertiliser that is insoluble in water??

Answers

Answer:

Nitrogen is mobile while phosphorus is immobile in the soil.

Explanation:

Nitrogen fertilizers are those fertilizers which provide nitrogen to the plants that is required by plants for the formation of amino acids. It increases vegetative growth of plant. Nitrogen fertilizer is highly mobile due to soluble in water and contaminated the underground water by leaching while phosphorus fertilizer are those fertilizer which provide second macro-nutrient i. e. phosphorus to the plants. Phosphorus is a vital component of energy molecule such as ATP. It is insoluble in water so it is immobile. Only 20 % of the applied phosphorus fertilizer is available to plants.

2 Describe why it would be an advantage for the seeds to be able to grow at any angle

Answers

Answer:

Seed grow at any angle is good for the plant because the barrier did not stop the plant growth.

Explanation:

If we planted a seed in the soil and there is any barrier such as stone or brick etc inside the soil so the roots change its direction because the seed grows at any angle. The shoot that emerge from the seed grow in upward direction if the stem is strong but some plants also grow horizontally due to weak stem so it is not compulsory for the plant to grow in only one direction, it grows whatever they want.

Explain how Darwin’s theory of evolution by natural selection may have led to all giraffes having long necks.

Answers

Answer:

Because this individual had a longer neck, it was able to reach food sources that other animals couldn't...

Which muscle tissues in the body are going to have the high number of Mitochondria and why?

Answers

Answer:

Skeletal muscle cells are long, cylindrical, multi-nucleated and striated. Each nucleus regulates the metabolic requirements of the sarcoplasm around it. Skeletal muscle cells have high energy requirements, so they contain many mitochondria in order to generate sufficient ATP.

PLEASEEE HELP!!! Can someone please help me with this question

Answers

Answer:

The answer is

Explanation:

The particle is a virus because it has genetic information and can infect humans.

Hope this helps....

Have a nice day!!!!

Answer:

A

Explanation:

1.What factors define aquatic ecosystems?

Answers

Answer:

In other words, physical or chemical parts of the environment that affect the organisms that are in that environment.

Explanation:

For aquatic ecosystems, these factors include light levels, water flow rate, temperature, dissolved oxygen, acidity (pH), salinity and depth. Light level is an important factor in aquatic ecosystems. hope this helps you :) god loves you :)

Light level is an important factor in aquatic ecosystems.

The physical or chemical parts of the environment that affect the organisms that are in that environment.

What is aquatic ecosystem?

An aquatic ecosystem is a water-based environment. Abiotic factors are the non-living components that form the environment in which organisms subsist in a current.

The main abiotic factors in the marine environment are as; light, temperature, salinity, and hydrostatic pressure. dissolved oxygen, acidity (pH), salinity and depth.

Here Without pollution or acid rain, most lakes and streams would have a pH level of around 6.5.

Therefore Light level is an important factor in aquatic ecosystems.

Learn more about aquatic ecosystems here;

https://brainly.com/question/22089101

#SPJ2

You are studying lipoprotein processing in a strain of mutant mice. You find that these mice synthesize the same apolipoprotein composition contained in lipoproteins made in the liver and the intestines, whereas, in wild-type mice there are 2 different sized apolipoproteins in these same tissues. Examination of the mRNA processing in the mutant mice would most likely show a defect in which of the following processes?A. alternative polyadenylationB. alternative splicingC. differential cappingD. posttranscriptional modification converting a U to a T residueE. RNA editing

Answers

Answer: Option E -- RNA Editing

Explanation:

It should be noted that, RNA editing can be defined as a molecular process via which some cells can make discrete changes to specific nucleotide sequences within an mRNA molecule after it has been generated by RNA polymerase. In addition, we have two major types of RNA editing with 1 being a C-to-U change catalyzed by cytidine deaminase that deaminates a cytidine base into a uridine base, e.g C-to-U editing is with the apolipoprotein B gene in humans. ApoB-100 is expressed in the liver and apoB-48 is expressed in the intestines. The B-100 form comprises of a CAA sequence that is edited to UAA, a stop codon, in the intestines.

Climate change is a threat to polar bears and other species that thrive on sea ice. Melting sea ice and changing precipitation patterns impact the bears’ ability to hunt and survive. In the past few decades, the number of polar bears in the Arctic region has dropped considerably. How might humans help to save these species?

Answers

Answer:

c.

Explanation:

Breed Polar bears in captivity , and then release them in the colder areas.

The colder the area the less of a chance there would be for the ice to melt fast enough sweeping away the bears shelter.

Climate change is the long-term alteration in weather patterns. It impacts the polar bears of the arctic region that can be saved by breeding them in captivity and then releasing them into their natural habitat.

What is the impact of climate change?

Climate change is the pattern of the disturbance in the weather and the temperature condition of the earth and its various places. It is a result of increased global warming caused by pollution.

Climate change affects the oceans and sea by raising their temperature leading to the melting of the ice caps and glaciers. This results in habitat destruction and decreases the population of arctic animals like polar bears.

To increase the population of polar bears, humans can breed them in an artificial environment and then can release them into their natural habitat like the colder places.

Therefore, the population can be increased by breeding.

Learn more about climate change here:

https://brainly.com/question/13908605

#SPJ5

What happens when the positive transcription factor affinity is slightly lower than the negative transcription
factor's affinity?
(1 point)
O mRNA is made in large quantities in frequent batches.
OmRNA is made in small quantities in infrequent batches.
O mRNA is made in large quantities in infrequent batches.
O mRNA is made in small quantities in frequent batches.

Answers

Answer:

O mRNA is made in small quantities in infrequent batches.

Explanation:

mRNA is made in small quantities in infrequent batches because the affinity of positive transcription is lower and affinity of negative transcription is higher which is responsible for production of mRNA from DNA molecule. Transcription is a process in which the information that is present in DNA molecule is copied to new mRNA molecule. Positive transcription factor is a promoter which promotes the initiation of transcription in order to enable RNA polymerase while negative transcription  factor is a repressor protein.

The process whereby the earth’s life changes over time through changes in genes of populations of organisms in succeeding generations is called____.a. emigration.b. mutation.c. natural selection.d. evolution.e. genetic drift.

Answers

Answer:

The correct answer is option : d. evolution.

Explanation:

Change in the heritable traits or characteristics of population of a organism over time by the adaption or changes in genes of such population over successive generation is known as the evolution.

These changes that cause the evolution of the biological population is caused by the process of adaption through natural selection that is the ability of the passing beneficial genes from parent to offspring.

Thus, the correct answer is option D. evolution.

what the parts of Earth's biosphere

Answers

Answer:

lithosphere, atmosphere and hydrosphere.

Explanation:

Answer:

the hydrosphere

the atmosphere

the lithosphere

Explanation:

The hydrosphere is all waters on the Earth's surface, such as lakes and seas, and sometimes including water over the Earth's surface, such as clouds.

The atmosphere is the Earth's layer of gases, commonly known as air, that is retained by Earth's gravity.

The lithosphere is the rigid part of the earth, consisting of the crust and upper mantle.

what would happen if the pons of the brain is damaged?​

Answers

Hello There!

Answer :

If the pons of the brain is damaged , it may cause a major interruption,loss of muscle control and function except for the eye movement in the body.Pons - Situated in the brain,Sends sensory information like signals through sleep patterns to the organs and muscles.

Hope this helps!

Have a nice Day!:)

Answer: If the pons of the brain is damaged , it may cause a major interruption, loss of muscle control and function except for the eye movement in the body.

Explanation: no wander

please give the correct answer to this question​

Answers

Answer: Lymphatic system

Explanation:

Not respiratory and excretory for sure.

Not nervous because the diagram doesn't show spinal nerves clearly. So its lymphatic system.

:-)

11. By what process do streams and rivers move material?
O infiltration
O mass wasting
O erosion
O weathering

Answers

It is called erosion

Erosion is the process by which Earth's surface is worn away by the action of water, wind, ice, or gravity. Hence option C is correct.

Streams and rivers are agents of erosion, and they move material by a variety of processes, including:

Dissolution - The water in a stream can dissolve minerals from the rocks and soil that it flows over.

Suspension - Fine particles of sediment can be suspended in the water and carried downstream.

Traction - Larger particles of sediment can be rolled or bounced along the bottom of the stream.

Saltation - Small pebbles and stones can be bounced along the bottom of the stream.

The type of erosion that a stream or river causes depends on the size of the particles that it is carrying. Streams and rivers that carry a lot of fine sediment are called suspended-load streams. Streams and rivers that carry a lot of large particles are called bed-load streams.

Erosion by streams and rivers can have a significant impact on the landscape. It can create valleys, canyons, and deltas. It can also transport sediment to other areas, where it can be deposited and form new landforms.

To know more about Erosion:

https://brainly.com/question/30587260

#SPJ6

List out the names of some
plants that grow in your village.
Which parts of it are used as
food?​

Answers

Answer:

Explanation:

The plants grown in my place are -  rice, groundnut, sugarcane, grapes, mulberry, castor, ragi etc.

Parts of it used as food

rice - seed

groundnut - seed

sugarcane - stem

grape - fruit

Mulberry - fruit

Castor - seed

ragi - filler millet

Hope this helps

plz mark as brainliest!!!!!!!

A scientist thinks that a certain chemical is a mutagen. She exposes plant cells to a large amount of this chemical in the laboratory. Which statement best provides evidence that the substance is a mutagen? -The cells die within hours of being exposed to the chemical. -The cells grow more quickly than those that were not exposed to the chemical. -The cells change after being exposed to the chemical, and this change is passed to the next generation of cells. -The cells continue to divide at the same rate as before they were exposed to the chemical.

Answers

Answer:

The cells change after being exposed to the chemical, and this change is passed to the next generation of cells.

Explanation:

Mutation is a process that occurs from time to time to the genetic material of living cells. Mutation is a change in the nucleotide sequence of a DNA or gene. It is usually caused by errors during replication or induced by an external substance called MUTAGEN.

A mutagen is any substance that causes mutation in an organism. Hence, according to the question, the chemical substance which is thought to be a mutagen will change the cells after being exposed to the chemical, and this change is passed to the next generation of cells.

N.B: Since mutation affects the gene, it is passed on to the offsprings during reproduction.

Answer:

its c did the test

Explanation:

what are the different types of waste? and what are the methods used in biodegrable waste managment​

Answers

Answer:

liquid waste , solid waste,harzadious waste,recyclable rubbish and organic waste

Which of the following is composed of a population of a species plus populations of other species? A. Community B. Biotic Potential C. Abiotic community D. Ecosystem

Answers

A Community is composed of a population of a species plus populations of other species. Thus, the correct option is A.

What is Population?

A Population may be defined as a group of individuals belonging to the same species living in the same area at a given time. Some demographic characteristics of a population are size, density, birth rate, death rate, population dispersal, etc.

A community may be defined as a group of individuals belonging to different species living in the same area at a given time.

An ecosystem may be defined as a place or area where individuals of different species along with abiotic factors live together and interact with one another for the purpose of food, shelter, and space.

The Abiotic community deals with the existence of abiotic factors like temperature, rainfall, fire, winds, mountains, hills, etc.

Therefore, a Community is composed of a population of a species plus populations of other species. Thus, the correct option is A.

To learn more about Community, refer to the link:

https://brainly.com/question/15971107

#SPJ5

what is the meaning of plasmolysis​

Answers

Answer:

. when a living plant cell loses water by osmosis , there is a contradiction or shrinkage of the components of the cell away from the cell wall . This phenomenon is known as plasmolysis . for example :- red blood cells shrink when placed in a salt solution .

Explanation:

this is an easy answer give me brainliest

Imagine an invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have:____. a. a cyclic variation depending upon when the animal drinks. b. regular variations that range from large to small. c. slight fluctuations that are kept within a narrow range. d. a cyclic variation opposite that of the surrounding water.

Answers

Answer: Option C.

slight fluctuations that are kept within a narrow range.

Explanation:

An invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have slight fluctuations that are kept within a narrow range so has to maintain homeostasis and prevent the cells of the the invertebrate from not shrinking which can be due to the salt solution (Hypertonic).

Estuary is an area of water or shorelines where river meet the ocean. It normal do have concentration of salts. Organisms that live in estuaries must be able to adapt to their dynamic environments, wich is due to variations in water chemistry includes salinity, as well as physical changes like the rise and fall of tides.

For each of the following types of transcriptional control, indicate whether the protein produced by the regulator gene will be synthesized initially as an active repressor, inactive repressor, active activator, or inactive activator.a. Negative control in a repressible operonb.b. Positive control in a repressible operonc.c. Negative control in an inducible operond.d. Positive control in an inducible operon

Answers

Answer:

The type of protein synthesized for each case of transcriptional control is given below:

a. Negative control in a repressible operon

Inactive repressor

b. Positive control in a repressible operon

Active activator

c. Negative control in an inducible operon

Active repressor

d. Positive control in an inducible operon

Inactive activator

Explanation:

Different types of operons exist in different bacterial systems and they control the transcription of genes by means of regulator proteins. These proteins are responsible for turning on or off the gene encoding a particuar protein depending on whether or not the cell requires for it.

A key component in the formation of organic compounds, such as nucleic acids and ATP

Answers

The correct answer is Phosphorus I just took the test.

Other Questions
Compare the value for the inductor when the current was increasing vs decreasing. Which statement matches the expected results. The inductance should be the same regardless of whether the current is increasing or decreasing. The inductance should be greater while the current is increasing. The inductance should be greater while the current is decreasing. after allowing 20 percent discount on the marked price of a radio 15 percent vat is levied on it , if its price become rs 22080 ,what amount was levied in the vat The image formed is 0.25 times the size of the object and 10 cm behind the pinhole. If the height of image on screen is 6 cm what is the distance of the object from the screen? The population distribution of SAT scores is normal with a mean of =500 and a standard deviation of SD=100. For example, what is the probability of randomly selecting an individual from this population who has an SAT score greater than 700? What occurs at the end of a females monthly cycle? The Coat of Arms includes two phrases, "Blessed are the peacemakers" and "Shame to him who evil thinks." Choose one of these phrases and explain why a ruler might want it included in a coat of arms A tour group is going sea diving. Sea level is O feet. The oceanfloor is -18 feet. One diver is already at -11 feet. The tour guideis keeping watch on the deck at 5 feet above sea level directlyabove the diver. What is the distance from the tour guide to thediver? Draw and label a number line to justify your answer. jawaban dari 5x 7 = 13 adalah....... dijawab ya.... An analyst takes a random sample of 25 firms in the telecommunications industry and constructs a confidence interval for the mean return for the prior year. Holding all else constant, if he increased the sample size to 30 firms, how are the standard error of the mean and the width of the confidence interval affected Restriction digest A:ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCCHow many bases are in the second fragment? Investment in human capital is very similar to investing in physical capital. True or false? Explain your answer. Given money demand, by how much would the Moola central bank need to change the money supply to close the output gap? TRUE OR FALSE The Enlightenment in the American Revolution rejected traditional religious, political and social values. The ratio of sales to invested assets, which is also a factor in the DuPont formula for determining the rate of return on investment, is called Rearrange the tiles so that it shows the proper steps of solving this quadratic equation using square property Instruments had retained earnings of at December 31, . Net income for totaled , and dividends declared for were . How much retained earnings should report at December 31, ? show that the point p(-6,2), Q(1,7) and R(6,3) are the vertices of scalene triangle The work function of a certain metal is = 3.55 eV. Determine the minimum frequency of light f0 for which photoelectrons are emitted from the metal. (Planck's constant is: h = 4.135710-15 eVs.) These box plots show daily low temperatures for a sample of days in two different towns. Yo tengo once aos y no tengo hermanos. Mitiene cuarenta aos. l es grande y cmico.padremadrehermanohija