4. True or False:

Every organism requires a set of instructions that specifies
its traits.

OTrue
O False

Answers

Answer 1

Answer:

True

Explanation:


Related Questions

one historic event related to Romanticism’s and explain how

Answers

Answer:

The early period of the Romantic era was a time of war, with the French Revolution (1789–1799) followed by the Napoleonic Wars until 1815. These wars, along with the political and social turmoil that went along with them, served as the background for Romanticism.

(Hope this helps, give a thanks if it did.)

Answer:

A historical events which greatly influenced Romanticism was The American Revolution (1775-1783),

Explanation:

Because Romantic poets were greatly influenced by the French and American revolutions, and these political uprisings were very much the driving force of change in the literary landscape.

BRAINLIEST PLEASE???

Choose two sentences that reflect the author's
viewpoint about Isaac Newton
1. "Newton's was such a monumental intellect
that, for example, when he found that the
mathematics required for some of his
Investigations did not exist, he invented it."
(Paragraph 1)
2. "Nearly three centuries would pass before the
world would host a comparable scientific
genius." (Paragraph 1)
3. "But before Newton there was no
understanding that an apple falling to earth
from a tree bore witness to the same physical
principle that keeps the planets revolving
around the sun." (Paragraph 2)
4. "Newton's view of gravity might be called the
great equalizer." (Paragraph 3)
S. "Newton went much further than this qualitative
description and wrote down equations that
quantitatively describe the strength of the
gravitational force between two objects."
(Paragraph 4)
hey

Answers

Answer: i think it is 1 and 5

Read this analogy, which was written by an anonymous online author.
My mind is like my web browser. 19 tabs are open, 3 are frozen and I have no idea where
the music is coming from.
Which statement BEST summarizes the purpose of this analogy?
O to show that the author is very productive at work
O to show that the author cannot keep up with technology
O to show that the author is bewildered and overwhelmed
O to show that the author is a deep, complex thinker

Answers

Answer: to show that the author is a deep, complex thinker

Explanation:

The statement that best summarizes the purpose of this analogy us option D " to show that the author is a deep, complex thinker".

According to the analogy, the author is comparing his or her mind to that of.a wen browser with different tabs. This shows that the author always have a complex thought regarding issues.

Answer:

O to show that the author is bewildered and overwhelmed

Explanation:

I took the exam

Which sentence uses a synonym context clue to help the reader understand the word gangly?

Answers

Answer:

Which type of context clue is used to help you figure out the meaning of ... Synonym context clue ... After reading the sentence represnted above, I recognized the type of ... out the meaning of the word jaunt and it is antonym context clue. ... you understand the meaning of the word petulantly in this sentence?

Explanation:

Stanzas containing three lines are called:
O quintains
O sestets
O tercets
O couplets

Answers

Answer:

tercets

Explanation:

what is meaning for bulb in hindi?​

Answers

Answer:

The word bulb means this in Hindi,  बल्ब

You write bulb बल्ब in hindi and it means electric lamp consisting of a transparent or translucent glass housing containing a wire filament (usually tungsten) that emits light when heated by electricity.

23. If you use a booster seat, always use it with a A. O lap and shoulder belt. B. O tethered harness with lap belt. C. O shield with safety belt. D. O all of the above​

Answers

Answer: A

Explanation:

I think it is A

Answer:

A

Explanation:

Which of the following behaviors suggests that while obedient, Charlotte is also intelligent? She does what she is told. She asks a lot of questions. She says very little. She recoils from the dirt and grime.

please help! ASAP!!

Answers

Answer:

She says very little.

Explanation:

Pls help how to delete an answer. I think i'm wrong

Answer:

I think the answer would be she does what she is told.

Explanation:

Being obedient means to comply with orders or requests, which she would be doing and if she's smart, she would know to follow orders so she wouldn't get in trouble.

100 POINTS!! PLZ HELP IT IS DUE TODAY!!!!!

Conduct research and collect five possible sources on one of the following topics. You may narrow your topic if you like, so long as your area of focus relates to one of the provided subjects.

slavery in the 1800s
women's rights in the 1800s
crossing the Atlantic in the 1800s
shipbuilding in the 1800s
Provide a bibliographic citation for each source. Two sources may be websites, and at least three sources should be books, journal articles, or magazine articles, either print or digital format. Keep in mind, that while Wikipedia is often a useful place to start research, it is not a credible source and should not be used as one of your sources. For credible and reputable websites, focus on library databases, university websites, and website addresses ending with a ".edu" or ".gov".
Your final answer should include a phrase or sentence that explains your selected topic, and a Works Cited page of the five sources, formatted in accordance with MLA style. Click here to view the MLA Style Guide.



AND DON"T SAY SRY, THE BIBLIOGRAPHIC IS YOUR WORK!!

Answers

Answer:

Explanation:

The slavery days are getting old

In 35 words or fewer, why do you think it's important to learn about the
purpose, context, and audience of a rhetorical work like a speech?

Answers

Write about how the purpose tells you about what you’re getting into/what you learn, the audience influences how the speech is written and why things are said the way they are, and the context provides background information that is necessary to understand it.

What motivated Nelson Mandela to fight for freedom in South Africa?

Answers

Answer:

The unshakeable belief in the equality of all people and his determination to overthrow the system of apartheid in South Africa.

Explanation:

He believed in equality and wanted to stop apartheid in South Africa. He wanted people to be treated equally.

HOPE THIS HELPED

What challenges does Captain Bunk face in the story

Answers

Answer:

story please

Explanation:

provide tye story whit this question please

. Which word means "a belief about something"?

Answers

Answer:

A.Opinion

Explanation:

Answer:opinion

Explanation:

Which game mentioned in the article lets the player act as a journalist?
A. Global Conflict: Palestine
C. Kuma War
B. Peacemaker
D. America's Army

Answers

Answer:

guy above is wrong

A Global Conflict: Palestine

Explanation:

Which of the following helps a group member ask good questions during a discussion? (1 point)
giving opinions
fuifling a tole
sharing ideas
istening closely

Answers

Answer:

Listening closely

Explanation:

PLEASE HELP I NEED IT

Answers

I think its the first and the third

I think it’s the 1st and 3rd not sure

Read the paragraph.

Music is an important element of a student’s education. One study says that schools with music programs had graduation rates of about ninety-three percent. In schools without music programs, the graduation rate dropped to around seventy-two percent.

What is the best transition to add at the beginning of the third sentence?

Conversely,
Finally,
Similarly,
Specifically,

Answers

Answer:

What is the best transition to add at the beginning of the third sentence?

Conversely

Explanation:

Correct answer is Option (C) Similarly

What is Music?  

Music is normally defined because the artwork of arranging sound to create some combination of shape, harmony, melody, rhythm or in any other case expressive content. Exact definitions of tune vary drastically round the arena, although it's miles an factor of all human societies, a cultural regular. While scholars agree that tune is defined by way of a few specific factors, there may be no consensus on their unique definitions. The advent of song is typically divided into musical composition, musical improvisation and musical performance.

The relationships and divisions among musical genres are loose and on occasion hotly contested, as in taxonomy. The mere lifestyles or legitimacy of a genre can be a topic of controversy. It is on occasion extra treasured to categorize tune with the aid of era, scene, cause, or inventive thought. Individual durations of tune are separated into portions, which can be classified into numerous traditions, inclusive of songs, tracks, symphonies, or so forth. Pieces may be composed and accomplished the usage of a great variety of gadgets, consisting of the human voice. There are totally instrumental pieces, totally vocal pieces, portions that integrate singing and contraptions, portions without a sound, randomly generated portions, or even portions merely specifying an surroundings without a further sonic organization.

To know more about music refer :

https://brainly.com/question/18044512

#SPJ2


I need help ASAP please

Which sentence is best structured to present two ideas of equal importance?
A. Since NASA was founded, it has sent more than 250 astronauts
into space.
B. The mission of NASA is to explore outer space.
C. Some people think that NASA should focus on exploring the
universe, but others believe that building a colony on the moon is
the most important goal, even though it will be difficult.
D. NASA is known for sending humans to the moon, but the famous
space program has also sent an unmanned spaceship to Mars.

Answers

Answer: A

Explanation: zoom in to see the picture.

Read the paragraph from the section "1. Define Small, Specific Goals."

A habit is a repeated behavior. Before you can develop a new habit, you'll need to define a small, specific behavioral goal. For example, instead of setting the goal of "being more organized" try "clean my room and vacuum every Sunday morning." This goal works because it's concrete. It's a behavior that you can repeat over and over until it becomes automatic – in other words, a habit.

How does this paragraph develop the central idea of the article?

a by elaborating on the types of habits most people want to form

b by emphasizing the difficulty of becoming more organized

c by explaining the first step toward achieving a habit you want

d by showing why large habit goals don't tend to work​

Answers

Answer: C

Explanation: Makes Complete sense, all about making the first step and having confidence moving forward.

“You know I never approved of it,” pursued Utterson, ruthlessly disregarding the fresh topic.
“My will? Yes, certainly, I know that,” said the doctor, a trifle sharply. “You have told me so.”
“Well, I tell you so again,” continued the lawyer. “I have been learning something of young Hyde.”
The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. “I do not care to hear more,” said he. “This is a matter I thought we had agreed to drop.”

–The Strange Case of Dr. Jekyll and Mr. Hyde,
Robert Louis Stevenson

Where in the plot is this passage found?

the exposition
the rising action
the falling action
the resolution

Answers

Answer:

rising action

Explanation:

The Strange Case of Dr. Jekyll and Mr. Hyde, Robert Louis Stevenson. In the plot, this passage finds the rising action. Hence, option B is appropriate.

What is the Robert Louis Stevenson?

Scottish novelist, essayist, poet, and travel writer Robert Louis Stevenson also wrote poetry. The books Treasure Island, Strange Case of Dr. Jekyll and Mr. Hyde, Kidnapped, and A Child's Garden of Verses are among his best-known.

The "boys' book" Treasure Island by Scottish author Robert Louis Stevenson is probably his most well-known work. He was a native of Edinburgh and the son of renowned engineer Thomas Stevenson.

On numerous instances, Stevenson pondered his mortality. Often ill since adolescence, he'd suffered from a persistent lung disease with symptoms typical of tuberculosis, notably breathing issues and spitting up blood. Robert Louis Stevenson was a literary giant who also used drugs frequently. He enjoyed using hashish, cocaine, and opium.

Hence, option B is correct.

Learn more about Robert Louis Stevenson here:

https://brainly.com/question/30086391

#SPJ7

Why journals don’t seek replication studies

Answers

Answer:

journals have developed a response procedure that casts doubt on the replication study authors first, before any questions are asked of the original authors.

Explanation:

Fate: In Beowulf, he makes the statement, “Fate always goes as it must.” which means Beowulf believes in whatever happens that it was destined to be, whether he won or lost in battle. In Macbeth, fate is another important idea. He says, “If chance will have me, king, why, chance may crown me, Without my stir.” which references that he is fine with accepting the fate of him becoming King. In this essay, discuss the role fate plays in these two texts and how it influenced the actions of Beowulf and Macbeth. Please provide textual evidence to support your writing from the two texts Macbeth and Beowulf.

Answers

Answer:

True

Explanation:

Answer:

dddddddd

Explanation:

ddddddddd

PLS ANSWER QUICKLY AND ILL MARK U BRAINLIEST
What is one similarity between a sitcom and one-act play
specific types of jokes
they both have one act
a main message
one main character

Answers

Answer: main message

How does perspective impact a person’s reaction to an event? i will mark as brianlyest write it in your own words

Answers

it impacts a persons reaction because of what point of view they see the event from which makes it more entertaining

(ELA) Which part of an opinion essay should sum up your entire argument?

A. conclusion
B. introduction
C. evidence
D. reasons

Answers

the answer is A because the intro is the beginning nd the reason in evidence is in the middle so it’s. A

Which of the following is NOT true
about John Locke?
A. He encouraged people to shake off unjust authority.
B. He did not believe in "divine right."
C. He was Prime Minister to King George III.
D. He influenced Thomas Jefferson

Answers

I think answer should be d. Please give me brainlest let me know if it’s correct or not okay thanks bye

Alice wrote an argument against replacing textbooks with tablets in her school. Here is one of her reasons and one piece of evidence to support it:

Reason: Many students have insufficient Internet access in their homes.

Evidence: About one-third of all Americans do not have broadband Internet at home.

Which of the following creates the strongest cohesion between Alice’s reason and the evidence?
A. Many students have insufficient Internet access in their homes. In fact, about one-third of all Americans do not have broadband Internet at home.
B. Many students have insufficient Internet access in their homes, but about one-third of all Americans do not have broadband Internet at home.
C. Many students have insufficient Internet access in their homes; about one-third of all Americans do not have broadband Internet at home.
D. Many students have insufficient Internet access in their homes; for example, about one-third of all Americans do not have broadband Internet at home.

Answers

D is correct, have a nice day!

Answer:

A. is correct

Explanation:

;-;

THE BIRD WITH THE BROKEN WING
PERSONS IN THE PLAY—The Bird, The Oak Tree, The Maple, The Willow. The Spruce, The Pine, The Juniper, The Forest Fairy, Jack Frost
SCENE I.-In the Woods
The Oak. See that flock of birds coming! The winter is near and they are flying south.
The Maple. I hope they will not light on my branches; I like to keep my leaves in order.
The Willow. So many birds will break my tender twigs. I am sure I do not want them either. Here they come!
[The birds fly over the trees.)
(from Dramatic Reader for Lover Grades by Florence Holbrook)
Which do the italicized words at the beginning of each line mean?
O 1. the scene of the play
2. the cast of characters
03. the setting of the play
4. the character speaking

Answers

Answer:

2 its the character list

Explanation:

h. When there is a lack of something and things are scarce
i. Someone who is eccentric has this quality
j. Something opaque has this quality
k Something that is electric has this
1. This is just a large or important town!
These words should end in - city

Answers

Explanation:

scarcity

eccentricity

opacity

central city

Historically, mining and purifying uranium hasn't been a very clean process. Even transporting nuclear fuel to and from plants poses a contamination risk. And once the fuel is spent, you can't just throw it in the city dump. It's still radioactive and potentially deadly. On average, a nuclear power plant annually generates 20 metric tons of used nuclear fuel, classified as high-level radioactive waste. When you take into account every nuclear plant on Earth, the combined total climbs to roughly 2,000 metric tons a year [source: NEI]. All of this waste emits radiation and heat, meaning that it will eventually corrode any container that holds it.

Choose the best concluding statement for this paragraph.

A) Nuclear power is a good thing, but no one can say how much of a good thing

B) The relative value of employing nuclear power depends largely on the circumstances.

C) Nuclear power involves many environmental dangers, which must be taken into consideration.

D) Nuclear power should be forbidden outright; whatever benefits it brings are far outweighed by the costs.​

Answers

Answer: C) Nuclear power involves many environmental dangers, which must be taken into consideration.

Explanation: I just did it on USATestprep

Answer:

It's C just did it

Explanation:

Other Questions
Translate these sentences/words in Spanish please1.How are you2. I need to go to the store3. Mother4. Talkative 5. Its freezing to death in my house6. Online7. Go to the movies with a friend8. Charger Names and places in Spanish down below;9.Olive10.Walmart 11.School 12.Holly 13.Crystal i need help pleaseeescreen shot attatched happy new year. eeeeeeeee e Simplify 5(x - 2) - 3x + 7.A. 8x - 3B. -10x + 25C. 2x-5D. 2x - 3 I need help ASAP please Which sentence is best structured to present two ideas of equal importance?A. Since NASA was founded, it has sent more than 250 astronautsinto space.B. The mission of NASA is to explore outer space.C. Some people think that NASA should focus on exploring theuniverse, but others believe that building a colony on the moon isthe most important goal, even though it will be difficult.D. NASA is known for sending humans to the moon, but the famousspace program has also sent an unmanned spaceship to Mars. DETERMINE THE MISSING SIDE Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT What caused the original creation of the Universe? How do we find out? A duck walked up to a lemonade stand and he said to the man running the stand: Create a flow chart that shows the hierarchy of the US Banking Systems. which is the correct graph for the equation? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Bryan wants to buy a new pair of jeans. If the jeans were originally $45.00, but are on sale with a 20% discount, how much will Bryan have to pay for the jeans? MR. ARCEO TAKES A TAXI FROM THE AIRPORT TO A HOTEL. THE TAXI CHARGES $2.50 INITIAL CHARGE PLUS $2.65 PER MILE. WHICH EQUATION CAN BE USED TO FIND Y, THE TOTAL COST OF THE TRIP, IF X REPRESENTS THE NUMBER OF MILES OF THE TRIP? Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia