a symbol used to name one or more parts of a whole or asset or a location on the number line is a

Answers

Answer 1

Answer:

Fraction is the answer


Related Questions

Please answer this question now

Answers

Answer:

25.13

Step-by-step explanation:

Answer:

C ≈ 25.13 feet

Step-by-step explanation:

A = πr²

16π = πr²

divide by π

16 = r²

r = 4

plug r into circumference equation:

C = 2πr

C = 2π(4)

C ≈ 25.13

hope this helps :)

algebraic expression twice the difference of a number and 5. with x being "a number"

Answers

Answer:

2(x-5)

Step-by-step explanation:

Answer:

the answer to your question is 5xa^2

or you can use symbolab calculator online

7. If 10 men can build a house in 90 days, how
many men can build a home in 20 days?
A) 18
B) 36
C) 45
D) 180

Answers

It would take 45 men to build a home

Answer:

2.222.........

Step-by-step explanation:

10 : 90

x : 20

cross multiply

10 x 20 =  90x

200 = 90x

both divide by 90

x = 2.2222.......

.
4 pumps can fill 800l of water in 20 min. In how many
minutes will 12 pumps fill 600l of water?
a) 6 min b) 5 min
c) 4 min d) 8 min​

Answers

Answer:

Step-by-step explanation:

One pump will fill 200l in 20 minutes

So the rate of filling per pump will be 10l/minute (200/20)

Let the number of minutes it will take to fill the 600l be x minutes

Now, since the rate of filling per pump is 10 l/minute

Then in x minute, they would have filled 10l/minute * x = 10x liters

So it is now this 10x liters that will be equal to 600

To find x, we simply divide

10x = 600

x= 600/10

x = 6 minutes

Use suitable identities to find the product of 1) (x-4) (x+10) 2) (3x+4) (3x +5) 3) (-3a +5b +4c)^2

Answers

Answer:

Step-by-step explanation:

(x-4) (x+10)  ⇒ (x+a)(x+b)=x²+(a+b)x+ab

a=-4 , b=10

x²+(-4+10)x+-4(10)

x²+6x-40

(3x+4) (3x +5)

3(x+4/3) *3(x+5/3)  ⇒ identity : (x+a)(x+b)=x²+(a+b)x+ab  

a=4/3    b=5/3

3*3=9

9[x²+(4/3 +5/3)x+4/3(5/3)]

9[x²+9/3 x+20/9]

9x²+27x+20

(-3a +5b +4c)^2  ⇒  

suitable identity is (a+b+c)²= a² + b² + c² + 2ab + 2bc + 2ca

a=-3a , b=5b , c=4c

9a²+25b²+16c²- 30ab +40bc - 24ca

100 Points!! Pls answer ASAP, short explanation as well. Thx!

Answers

Answer:

2/3 x [tex]\sqrt[4]{y^2}[/tex]

Step-by-step explanation:

( 16 x^11 y^8 / 81 x^7 y^6) ^ ( 1/4)

Simplify the expression inside the parentheses

Rewriting the constant

16/81 = 2^4 / 3^4 = (2/3) ^4

Next the x terms

x^11 / x^7

We know that a^b / a^x = a^ ( b-c)

x^ (11-7) = x^4

And finally the y term

y^8/ y^6 = y^( 8-6) = y^2

(  (2/3) ^4 x^4 y^2) ^ ( 1/4)

We know that (ab) ^ c = a^ c * b^c

 (2/3) ^4 ^ 1/4   ( x^4 ^ 1/4   ( y^2) ^ ( 1/4)

We know that a^ b^ c = a^ ( b*c)

(2/3) ^4 ^ 1/4   ( x^4 ^ 1/4   ( y^2) ^ ( 1/4)

( 2/3) ^ ( 4*1/4)  * x^ ( 4*1/4)   * y ^ ( 2 ^ 1/4)

2/3 * x *  y ^ 2/4

2/3x  y ^ 2/4

2/3 x [tex]\sqrt[4]{y^2}[/tex]

━━━━━━━☆☆━━━━━━━

▹ Answer

See below for attached work.

▹ Step-by-Step Explanation

Hope this helps!

CloutAnswers ❁

━━━━━━━☆☆━━━━━━━

whats the squareroot of 144 needs to be simplified

Answers

Answer:

12

Step-by-step explanation:

The square root of any number is basically asking "what number multiplied by itself will equal this number?"

Usually you memorize these, but there's also a quick way to do it.

We know that [tex]10\cdot10=100[/tex], so the square root must be greater than 10.

We also know that [tex]15\cdot15=225[/tex], so the square root must be less than 15.

A good mid point between these numbers is 13. Let's see what 13 squared is:

[tex]13\cdot13=169[/tex]

So it's a bit less than 13. Let's try 12.

[tex]12\cdot12=144[/tex]

So 12 is the square root of 144.

Hope this helped!

Answer:

[tex]\huge\boxed{\sqrt{144}=12}[/tex]

Step-by-step explanation:

[tex]\begin{array}{c|c}144&2\\72&2\\36&2\\18&2\\9&3\\3&3\\1\end{array}\\\\144=2\cdot2\cdot2\cdot2\cdot3\cdot3=2^2\cdot2^2\cdot3^2\\\\\sqrt{144}=\sqrt{2^2\cdot2^2\cdot3^2}=\sqrt{2^2}\cdot\sqrt{2^2}\cdot\sqrt{3^2}=2\cdot2\cdot3=12\\\\\text{Used}\\\\\sqrt{ab}=\sqrt{a}\cdot\sqrt{b}\\\sqrt{a^2}=a\\\\\text{for}\ a\ge0,\ b\geq0[/tex]

Find the total surface area.

Answers

Answer:

143.4 mi²

Step-by-step explanation:

Top: 8x6=48

Bottom: 3x8=24

Sides: 3x8=24 and 24

Trapezoids sides: (6+3)/2*2.6=4.5*2.6=11.7 and 11.7

TOTAL: 48+24+24+24+11.7+11.7= 143.4 mi²

A balloon artist creates balloon hats for children at a store’s grand opening. The graph shows the number of balloons the artist has remaining, y, after creating x hats.

A coordinate plane showing Balloon Hat Creations. The x-axis shows Number of Balloon Hats and the y-axis shows Balloons Remaining. The straight line starts at (0. 500) and continues down and to the right through points, (50, 250) and ends at (100, 0).
What phrases can be used to describe the line representing the relationship between the number of balloons remaining and the number of hats created? Select three options.

positive slope
negative slope
constant slope
increasing function
decreasing function

Answers

Answer:

B, C, E

Step-by-step explanation:

I just took the test

Answer:

i dont know if im correct but

Step-by-step explanation:

B, C, and E are the right ones hope it helps

If Ab = 54, find MC.

Answers

Answer:

MC = 45

Step-by-step explanation:

Δ ABH and Δ MCH are similar and the ratios of corresponding sides are equal, that is

[tex]\frac{AB}{MC}[/tex] = [tex]\frac{AH}{MH}[/tex] , substitute values

[tex]\frac{54}{MC}[/tex] = [tex]\frac{6}{5}[/tex] ( cross- multiply )

6MC = 270 ( divide both sides by 6 )

MC = 45

PLEASE HELP FOR REAL
In exercises 22 24 , describe how the change affects the surface area of the right prism or right cylinder .

Answers

Answer:

  22. The surface area is 1/9 of its original value

  24. The surface area is 120 m^2 less than its original value.

Step-by-step explanation:

22. For similar figures, the surface area is proportional to the square of the linear dimension scale factor. Multiplying all linear dimensions by 1/3 will result in reducing the surface area to (1/3)^2 = 1/9 of its original value.

__

24. As above, the scaled base surface area will be (1/4)^2 = 1/16 of its original value. Since one dimension of the lateral area is multiplied by 4 and the other dimension is multiplied by 1/4, the net effect on that area is multiplication by (1/4)(4) = 1. That is, the lateral area will remain unchanged.

The overall surface area will be reduced by 15/16 of the area of the bases. The area of the bases is (2)(1/2)(8 m)(16 m) = 128 m^2. The changed figure will have a surface area that is 120 m^2 smaller.

Help ASAP In a system of linear equations the two equations have the same slope. Describe the possible solutions to this equation.

Answers

Answer:

If the two linear equations have the same slope, the equations represent the same line. Since a line intersects with itself everywhere, there will be an infinite number of solutions.

PLZ HELP ME!!!! I NEED THE ANSWER QUICK SO IM GIVING BRAINLIEST TO THE FASTEST AND BEST ANSWER.

Answers

Answer:

f(x) = 8(1/2)^x.

Step-by-step explanation:

According to the graph, there is a point at (0, 8) and (1, 4).

That means that when x = 0, y = 8.

8 = a(b)^0

1a = 8

a = 8

That means that a = 8, and when x = 1, y = 4.

4 = 8(b)^1

4 = 8b

8b = 4

b = 4/8

b = 1/2

So, f(x) = 8(1/2)^x.

Hope this helps!

What is the solution to

Ax+ bx + C=0

Answers

Answer:

x = -C / (A + b)

Step-by-step explanation:

Without given values for the constants A, b, and C (Assuming they are constants), the best we can do is to isolate the variable x.  Let's proceed to solve for x.

Ax + bx + C = 0

x (A + b) + C = 0

x (A + b) = -C

x = -C / (A + b)

So now, when you get the values of the constants A, b, and C, you can plug those in to solve for variable x.

Cheers.

Am I doing this right if not please help me

Answers

Answer:

Step-by-step explanation:

For the m it would just be -3 because the equation for slope intercept form is y=mx+b

4x + 5 = x + 26​ need help

Answers

Answer:

x = 7

Step-by-step explanation:

4x + 5 = x + 26

4x - x = 26 - 5

3x = 21

x = 21/3

x = 7

Check:

4*7 + 5 = 7 + 26

28 + 5 = 33

Please, i need answer fast :< no steps, ILL GIVE BRAINLIEST TOO :)

Answers

Answer:

[tex]\huge\boxed{Area = 24\ square\ units}[/tex]

Step-by-step explanation:

Area of parallelogram = Base * Height

Where Base = 6 , Height = 6

Area = 6 * 4

Area = 24 square units

Answer:

24 square units

Step-by-step explanation:

the area formula is A=bh

b=6

h=4

A=4*6

A=24

can any one help me in this..???? please

Answers

Answer:

(i) a1/a2 =/ b1/b2

(ii) a1/a2=b1/b2 =/ c1/c2

(iii) a1/a2=b1/b2=c1/c2

Step-by-step explanation:

=/ means not equal to.

graphical repesentation of

1.intersecting lines

2.coincident lines

3.parallel lines

a1/a2 and next two slots is basically dividing the coefficents if each equation.

for eg. 1. a1/a2= 2/4=1/2 and so on.

parallel lines are inconsistent whereas intersecting and coincident lines are consistent.

If the factors of function f are (x − 6) and (x − 1), what are the zeros of function f?



A.-6 and -1

B. -1 and 6

C. 1 and 6

D. -6 and 1

Answers

Answer:

I think C is the answer .

Step-by-step explanation:

If (x-6) and (x-1) are the factors of function f then remainder of function f is 0.

(x-6)(x-1) = 0

Either,

x-6 = 0

x = 6

and

x-1 = 0

x = 1

so 6 and 1 are the zeros or roots of function f.

Answer:

the answer is 1 and 6 :D

Step-by-step explanation:

7x-y= 22
4x + 2y = 10
can someone help plz?

Answers

Answer:

x = 3

y = -1

Step-by-step explanation:

Based on the fact that our have two variables and two equations, I'm going to assume you are trying to find the values of x and y.

For these two equations, let's first find the value of x using the equation elimination method.

We're going to eliminate the y variable by multiplying the first equation by 2 and then adding that new equation to the second equation.

7x - y = 22 ==> 14x - 2y = 44

4x + 2y + (14x - 2y) = 10 + (44)

18x + 0y = 54

x = 3

Now we plug the value of x back into one of the equations to find the value of y.

7x - y = 22

7(3) - y = 22

-y = 22 - 21

y = -1

So our values are as follows:

x = 3

y = -1

Cheers.

The physician orders 1500 flu injections. There were 300 shots given in September, 450 shots given in October, and 665 shots given in November. What percentage of flu vaccine has been given?

Answers

Answer:

94.33

Step-by-step explanation:

add up all numbers then input into a percentage calculator

Percentage of flu vaccine has been given 94.33%

What is percentage?

Percentage is defined as ratio expressed as a fraction of 100.

The physician have total 1500 flu injections

300 shots given in September,

450 shots given in October,

and 665 shots given in November,

Total flu vaccine has been given = 300+450+665 = 1415

Percentage of flu vaccine has been given = (1415/1500)×100%

Percentage of flu vaccine has been given = 0.9433×100%

Percentage of flu vaccine has been given = 94.33%

Hence, percentage of flu vaccine has been given 94.33%

Learn more about percentage

brainly.com/question/24159063

#SPJ2

Simplify the scalar multiplication on the matrix.

Answers

Answer:

third option

Step-by-step explanation:

Given

3 [tex]\left[\begin{array}{ccc}-2&5\\1&0\\\end{array}\right][/tex]

Multiply each element in the matrix by 3

= [tex]\left[\begin{array}{ccc}3(-2)&3(5)\\3(1)&3(0)\\\end{array}\right][/tex]

= [tex]\left[\begin{array}{ccc}-6&15\\3&0\\\end{array}\right][/tex]  

Answer:

C.

Step-by-step explanation:

what is the system is equations 5x+4y=8 2x-3y=17

Answers

Answer:

  (4, -3)

Step-by-step explanation:

The system of equations can be described a number of ways. One possible description is "a consistent pair of linear equations in two variables."

Perhaps you want to know the solution to this system of equations. I find it easiest to graph them. The attached graph shows the solution to be ...

  (x, y) = (4, -3)

__

You can also use "elimination" to simplify the system to a single equation in a single variable. Adding 4 times the second equation to 3 times the first will do that.

  3(5x +4y) +4(2x -3y) = 3(8) +4(17)

  23x = 92 . . . . . simplify

  x = 4 . . . . . . . .  divide by 23

Substituting this value into the first equation, we have ...

  5(4) +4y = 8

  5 +y = 2 . . . . . . divide by 4

  y = -3 . . . . . . . . subtract 5

The solution is (x, y) = (4, -3).

Can someone please help!

Answers

Plot point F where angle alpha is located.

Triangle ABF has two interior angles x and 80. They add to the exterior angle alpha due to the remote interior angle theorem.

alpha = x+80

Answer: Choice D

what is the general form to find square roots

Answers

Answer:

see below (I hope this helps!)

Step-by-step explanation:

Square roots are usually in the form a√b where a and b are any rational number.

Match the graph with the correct equation.

Answers

Answer:

work shown and pictured

An office supply store recently sold a black printer ink cartridge for $14.99 and a color printer ink cartridge for $20.99. At start of a recent fall semester, a total of 42 of these cartidges was sold for a total of $695.58. How many of each type were purchased?

Answers

Answer:

B = 31, C = 11

Step-by-step explanation:

Let B be the number of Black printer ink cartridges and C be the number of color printer ink cartridges.

42 were sold in total, hence,

B+C= 42 ------------(1)

Also, its given that

14.99 B+20.99C= 695.58 ------(2)

Multiplying (1) by 20.99,

14.99 B+14.99 C= 629.58 ------(3)

Now, subtracting (3) from (2),

14.99 B+20.99C= 695.58

14.99 B+14.99 C= 629.58

------------------------------------

6 C = 66

C= 66/6

C = 11

We know, B+ C= 49

Hence B = 42- 11 = 31

B = 31

Hence, number of Black printer ink cartridges = 31 and color printer ink cartridges = 11 .

Evaluate the expression when y=-6.

y^2+5y-2​

Answers

Answer:

this glizzy

Step-by-step explanation:

blow this glizzy u madd u wrong answer

Answer:

  4

Step-by-step explanation:

Sometimes when evaluating polynomials, it is easier if you write them in Horner form:

  (y +5)y -2

For y = -6, this is ...

  (-6 +5)(-6) -2 = (-1)(-6) -2 = 6 -2 = 4

The value of your expression is 4.

a trader bought 90oranges at 3 for gh¢ 0.75 .how much did she get from selling all​

Answers

Answer:

How much did she sell it

Can somebody please help me

Answers

Exact area = 25piApproximate area = 78.5

You can pick one or the other to have as your answer

===========================

Explanation:

The formula you use is

A = pi*r^2

The radius is r = d/2 = 10/2 = 5

So,

A = pi*r^2 = pi*5^2 = pi*25 = 25pi

is the exact area

Replace pi with 3.14 to get 25*pi = 25*3.14 = 78.5

which is the approximate area

To get a better approximation, you would use more decimal digits of pi.

Other Questions
Mario invested $5100 at 13% to be compounded daily. What will be the value of Mario's investment in 2 years? Round your answer to the nearest cent, if necessary. Note: 365 days in a year and 30 days in a month. The anticodon (Select all that apply): a. is a triplet of nucleotides in tRNA b. determines the identity of the amino acid to be added to the peptide chain c. is complementary to the codon d. binds to the codon via hydrogen bonds Compare the value for the inductor when the current was increasing vs decreasing. Which statement matches the expected results. The inductance should be the same regardless of whether the current is increasing or decreasing. The inductance should be greater while the current is increasing. The inductance should be greater while the current is decreasing. after allowing 20 percent discount on the marked price of a radio 15 percent vat is levied on it , if its price become rs 22080 ,what amount was levied in the vat The image formed is 0.25 times the size of the object and 10 cm behind the pinhole. If the height of image on screen is 6 cm what is the distance of the object from the screen? The population distribution of SAT scores is normal with a mean of =500 and a standard deviation of SD=100. For example, what is the probability of randomly selecting an individual from this population who has an SAT score greater than 700? What occurs at the end of a females monthly cycle? The Coat of Arms includes two phrases, "Blessed are the peacemakers" and "Shame to him who evil thinks." Choose one of these phrases and explain why a ruler might want it included in a coat of arms A tour group is going sea diving. Sea level is O feet. The oceanfloor is -18 feet. One diver is already at -11 feet. The tour guideis keeping watch on the deck at 5 feet above sea level directlyabove the diver. What is the distance from the tour guide to thediver? Draw and label a number line to justify your answer. jawaban dari 5x 7 = 13 adalah....... dijawab ya.... An analyst takes a random sample of 25 firms in the telecommunications industry and constructs a confidence interval for the mean return for the prior year. Holding all else constant, if he increased the sample size to 30 firms, how are the standard error of the mean and the width of the confidence interval affected Restriction digest A:ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCCHow many bases are in the second fragment? Investment in human capital is very similar to investing in physical capital. True or false? Explain your answer. Given money demand, by how much would the Moola central bank need to change the money supply to close the output gap? TRUE OR FALSE The Enlightenment in the American Revolution rejected traditional religious, political and social values. The ratio of sales to invested assets, which is also a factor in the DuPont formula for determining the rate of return on investment, is called Rearrange the tiles so that it shows the proper steps of solving this quadratic equation using square property Instruments had retained earnings of at December 31, . Net income for totaled , and dividends declared for were . How much retained earnings should report at December 31, ? show that the point p(-6,2), Q(1,7) and R(6,3) are the vertices of scalene triangle The work function of a certain metal is = 3.55 eV. Determine the minimum frequency of light f0 for which photoelectrons are emitted from the metal. (Planck's constant is: h = 4.135710-15 eVs.)