An animal shelter provides a bowl with 1.25 liters of water for 5 cats.


About how much water will be left after the cats drink their average daily amount of water?


Water Consumption

Animal Average Amount

(Liters per day)

Canada Goose 0.24

Cat 0.15

Mink 0.10

Opossum 0.30

Bald Eagle 0.16



liter(s) of water will be left after the cats drink their average daily amount of water.

Answers

Answer 1

Answer:

.50 left

Step-by-step explanation:

You have to multiply .15 times 5, then get that and subtract that number by 1.25, but do not worry about the decimal just add that in later, and the answer is .50


Related Questions

A. 50 degrees
B. 130 degrees
C. 9 units
D.22 units
E. 13 units

Answers

Answer: all i can do hope this helps a bit 2. 130 degrees

5. 13 units

please answer asap correctly dont troll!!!

Answers

Answer:

10

Step-by-step explanation:

Bro, again the same question))

a>17-8

a>9

Tyrone walked 8 miles in a walkathon at a speed of 2 miles per hour. How long was he walking?
4 hours
6 hours
10 hours
16 hours

Answers

Answer:

4 hours

Step-by-step explanation:

Answer:

the answer is 4 HOURS

Step-by-step explanation:

i took the exam

Please help I’m stuck!!!!

Answers

Answer: abe

Step-by-step explanation: start at origin and is proportional

Hello? STOP RIGHT THERE.... Please help me with this.

Answers

Answer: THE ANSWER IS 2 :)

Step-by-step explanation:

3(q+2)  Do distributive property

3q=6 Divide 3q to both side

3q = 3q

q= 2       This is the answer

Solve for “z.”

Please help!

Answers

Answer: Z=5

Step-by-step explanation:

Solve the rational equation by combining expression and isolating the variable z

A rectangle is made up of green and red tiles. the ratio of green tiles to red tiles is 3:4. Which of the following could be the number of green tiles in the rectangle?

Answers

Answer:

H) 24

Step-by-step explanation:

24 is the only number that is divisible by 3.

CHECK:

3 x 8 : 4 x 8

24:32✔

(You can try dividing '3' by the other numbers to also check your answer)

Hope this helped ^^

Percy bought an encyclopedia pried at $13.85 shipping and handing cost an additional 20 percent of the price

Answers

Answer:

Percy spent $2.77 for shipping and handling.

Step-by-step explanation:

2.77 is 20 percent of 13.85

HELP PLEASE PLEASE!!!

Answers

x=64Step-by-step explanation:

if a bike race covers 120 mi over 6 days and the cyclists ride the same distance every day how many miles does each cyclist ride each day​

Answers

120/6= 20
they ride 20 miles each day

Suppose you are testing two fertilizers on bamboo plants A and B, which are growing under identical conditions. Plant A is 6 cm tall and growing at a rate of 4 cm per day. Plant B is 10 cm tall and growing at a rate of 2 cm per day.​

Answers

Answer:

2 days

Step-by-step explanation:

Step one:

let the number of days be x

and the total height be y

​Plant A is 6 cm tall and growing at a rate of 4 cm per day.

the total height is

y=6+4x------------1

Plant B is 10 cm tall and growing at a rate of 2 cm per day.​

y=10+2x-----------2

Required

time taken for both plants to have the same height

Step two:

equate the two equations to find when the plants will have the same height

6+4x=10+2x

collect like terms

4x-2x=10-6

2x= 4

divide both sides by 2

x= 4/2

x= 2 days

A figure has been dilated from the origin by a scale factor of one seventh. if another dilation from the origin maps the dilated image back
onto the original figure, what is its scale factor?

Answers

Answer:

its scale factor is 3

Step-by-step explanation:

plz mark brainliest

To map the dilated image back  onto the original figure, the scale factor needed is 7.

Transformation is the movement of a point from its initial location to a new location. Types of transformation are rotation, reflection, translation and dilation.

Dilation is the increase or decrease in the size of a figure by a factor.

If a figure is dilated from the origin by a scale factor of one seventh, it is given by:

(x, y) ⇒ [(1/7)x, (1/7)y]

To map the dilated image back  onto the original figure, the scale factor needed is 7. Hence:

[(1/7)x, (1/7)y] ⇒ (x, y)

Find out more at: https://brainly.com/question/11707700

If the weight of a package is multiplied by 7/10 the result is 21 pounds. Find the weight of the package.

Answers

Answer:

30 pounds

Step-by-step explanation:

take the 21 pounds and divide it by 0.7

Answer:

30

Step-by-step explanation:

[tex]21 / 0.7=30[/tex]

Check

30 x 0.7 = 21


.is BLANK
than
is fewer
than
3 < 5

Answers

Answer:

I do not know what you just said so I assume your asking if 3 is less than 5 and yes 3 is less than 5

4/x = 2/7 please help ASAP!!

Answers

Answer:

use cross multiplication to solve

4*7 = 2*x (multiply)

28 = 2x (divide both sides by 2 to isolate x )

x = 14 (your answer)

Step-by-step explanation:

I hope this helped :)

Answer:

Step-by-step explanation:

Or,2×x=7×4

Or,2x=28

Or,x=14

Which point is coplanar with C, F, and G in the diagram below?

1. H
2.E
3.B
4.D

Answers

Step-by-step explanation:

The only face of the cube that has all the points C, F and G is the face CFGD on the right facing outwards.

Hence point D must be coplanar as it is on the same face.

Point D  is coplanar with C, F, and G in the diagram of rectangular prism option (4) D is correct.

What is a rectangular prism?

It is defined as the six-faced shape, a type of hexahedron in geometry.

It is a three-dimensional shape. It is also called a cuboid.

It is given that:

The rectangular prism is given in the picture.

The rectangular prism is a three-dimensional figure.

As we know, geometry can be defined as the branch of mathematics that is concerned with the size, shape, and orientation of two-dimensional figures.

The cuboid can be defined as a six-faced shape, a type of hexahedron in geometry. It is a three-dimensional shape.

Thus, point D  is coplanar with C, F, and G in the diagram of rectangular prism option (4) D is correct.

Learn more about the rectangular prism here:

brainly.com/question/21308574

#SPJ2

Cindy types 180 words in 2 minutes
Enter the number of words Cindy types in 5 minutes at this rate.

Answers

She types in 450 words in 5 minutes
180/2=90
90*5=450

List all the factor pairs for 48. make a table to help and add the table.

Answers

Answer:

The factor pairs of the number 48 are: 1 x 48, 2 x 24, 3 x 16, 4 x 12, and 6 x 8

Step-by-step explanation:

What is the solution of the equation? square root b - 17 + square root b = 1?

Answers

Answer: no solution hope this helps

Answer:

D. No solution

Step-by-step explanation:

correct on edg unit test review, hope that helped!

Thomas ram from the start line to go post and back the distance from the start line to the goalpost is 46 meters how far did Thomas run

Answers

Answer:

92m!

Step-by-step explanation:

46 times 46 is 92

please give me brainliest!!!<3

Please help me solve this challanging question 9 (step by step sulotion) 50 points!

Answers

9514 1404 393

Answer:

  10

Step-by-step explanation:

Let L and T represent the initial amounts that Leo and Theo had. Let n represent the number of bills exchanged in the first exchange. Then we have ...

  L -20n +50n = T -50n +20n . . . . after the first exchange, each has the same

After the second exchange, amounts trade places:

  (L +30n) +6(50) = T

Substituting this into the first equation, we get ...

  L +30n = ((L +30n) +300) -30n

  30n = 300

  n = 10

Leo gave Theo ten $20 bills.

_____

Comment on the amounts

Theo started with $600 more than Leo, including exactly 16 $50 bills. Leo had at least 10 $20 bills, so he could make the initial exchange. Whatever initial amount Leo had in excess of that $200 was matched in Theo's initial amount, but Theo must have had that excess in $20 bills only. For example, Leo may have started with $300 as 10×$20 +2×$50, but Theo's initial $900 would need to be 5×$20 +16×$50.

What is 3 1/2 as an improper fraction?

Answers

Answer:

7/2

Step-by-step explanation:

Step 1

Multiply the denominator by the whole number

2 × 3 = 6

Step 2

Add the answer from Step 1 to the numerator

6 + 1 = 7

Step 3

Write answer from Step 2 over the denominator

7/2

the improper fraction form of 3 1/2 is 7/2.

To convert the mixed number 3 1/2 to an improper fraction, we first multiply the whole number (3) by the denominator (2) and add the numerator (1). This gives us 3 * 2 + 1 = 7 as the new numerator. The denominator remains the same, which is 2. So, the improper fraction form of 3 1/2 is 7/2.

In this fraction, the numerator (7) represents the total number of parts we have, while the denominator (2) represents the size of each part. Therefore, 3 1/2 is equivalent to the improper fraction 7/2.

Learn more about improper fraction here

https://brainly.com/question/21449807

#SPJ6

The price of an item has been reduced by 15%. The original price was  $87.​

Answers

Answer:

The new cost is $73.95

The discount was $13. 05

Step-by-step explanation:

Turn the % into a decimal so it would be 0.15.

Then multiply it to the total, 87 x 0.15 = 13. 05

so the discount subtracted $13.05 off of the original price.

87 - 13. 05 = 73.95

I GIVEEE BVRAINLILSDTTTTTTTT

Answers

Answer:

c=10,3

D=0,3

E=0,6

F=10,6

pls give brainliest

Answer:

ghtfgngngnfgjyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy

Step-by-step explanation:

ngfngfnfgnfgnfg

The product of 7 and j is 91.
Solve for j

Answers

Answer:

j=13

Step-by-step explanation:

The equation for this problem is 7j=91.

I would divide 7 on both sides, which would be j=13.

Jaye walked 50 dogs this week. 40% of the dogs were brown. How many of the dogs were brown?

Answers

Answer: 30

Step-by-step explanation:

50x .4 = 20

50-20=30

40% in decimal form is .04 so to find out the answer you must multiply 50 by .04 which gives you 20. There are 20 brown dogs.

So the African bush elephant weighs between 4.4 tons and 7.7 tons what are its least and greatest weights rounded to the nearest ton ?

Answers

Answer:

least: 4 tons, greatest: 8 tons

Step-by-step explanation:

.4 round down (5 and up, round up rule)

.7 round up

What is the value of the expression 9 + ( fraction 1 over 2 )4 ⋅ 48?

Answers

Answer:

105

Step-by-step explanation:

9 + (1/2)4 x 48

9 + 96 = 105

Answer:

105

Step-by-step explanation:

SO, based on the way you worded it, the equation is

[tex]9 + 1/2 *4*48[/tex]

You multiply [tex]1/2 * 4[/tex] first.

This gives you 2.  [tex]2*48=96[/tex]

96 + 9 =105

Which data sets have outliers? Check all that apply
14,21,24,25,27,32,35
15,30,35,41,44,50,78
16,32,38,39,41,42,58
17,23,28,31,39,45,75
18,30,34,38,43,45,68

Answers

Answer:

C.16, 32, 38, 39, 41, 42, 58

and

E.18, 30, 34, 38, 43, 45, 68

its C. & E.

they both have outliers lol

4xr=14 pls i need help.

Answers

Answer: x =7/2 or r = 7/2 so this means there the same.

Step-by-step explanation:

>> Answer

_________

[tex] \: [/tex]

4 × r = 14

4r = 14

r = 14/4

r = 7/2

r = 3½ or 3,5

Other Questions
Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT What caused the original creation of the Universe? How do we find out? Create a flow chart that shows the hierarchy of the US Banking Systems. TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia List two equivalent numbers to 0.50 Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make? You know I never approved of it, pursued Utterson, ruthlessly disregarding the fresh topic.My will? Yes, certainly, I know that, said the doctor, a trifle sharply. You have told me so.Well, I tell you so again, continued the lawyer. I have been learning something of young Hyde.The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. I do not care to hear more, said he. This is a matter I thought we had agreed to drop.The Strange Case of Dr. Jekyll and Mr. Hyde,Robert Louis StevensonWhere in the plot is this passage found?the expositionthe rising actionthe falling actionthe resolution How do blood types react in a transfusin ? Tarshiss article is mainly about A. the U.S. Navys secret missions B. the construction of the Titanic C. creatures that thrive in the deep seaD. one mans quest to find the Titanic Which of the following is an example of a topic that is too narrow or not going have enough information?Explaining the process of solar power.The effects of drought on farmers in California.The process of inflating a flat bicycle tire.Comparing the North and South poles. plz help me with this PLS ANSWER QUICKLY AND ILL MARK U BRAINLIESTWhat is one similarity between a sitcom and one-act playspecific types of jokesthey both have one acta main messageone main character The atomic number tells the number of What current passes through a 1 kW heater with 25 V across it?