Answer:
As nouns the difference between pathogenesis and pathogenicity. is that pathogenesis is the origin and development of a disease while pathogenicity is the quality or state of being capable of causing disease.
How does water relate to the ability of a living thing to generate usuable energy?
Answer:
Without the proper balance of water, chemical reactions in cells could not take place.
Explanation: :)
Should we clone animals that are going or have gone extinct (in other words bring them back
either from the brink of extinction or from extinction)? Explain your answer.
Answer:
I think we should but people are preventing this though
Explanation:
I think we should because it might benefit the world and let scientists to discover this animal. But then I don't think so because animals that are/were extinct could perhaps be from climate change. Nowadays, people don't take this matter seriously causing habitats to be destroyed and animals to be extinct :) Like icebergs are melting that mean penguins are at risk of being extinct,if we did something then this situation will be prevented. However dinosaurs did become extinct and they did not come back so its probably just life and this is how god planned it:)
Which quantity does a light year measure
Answer:
distance = 9.46 trillion kilometers
Explanation:
Light years measure distance and is a unit that equals the distance light travels through space in one year on Earth (365 days) and is used as way to measure extremely vast distances in outer space. It equals 9.46 trillion kilometers.
Help me out with this again, pretty please?
(2nd time)
I need explanation for your answers, even though it's multiple choices, I still need your explanation for it.
DUE TOMORROW!
If your answer is NONSENSE it will be deleted as soon as possible!
But if your answer is CORRECT, HELPFUL, HAS AN EXPLANATION, I'll chose your answer as the BRAINLIEST ANSWER!
Consider the following statements:
1. RNA is ribonucleic acid.
2. RNA is used for information transport (known as mRNA). Choose the correct answer from the given codes:
A Only 1
B Only 2
C Both
D Neither 1 nor 2
E None of the above
Answer:
Only A
Explanation:
RNA is used for storing and transporting information through mostly virus only..
14.
(GT.03)
Which of these best matches a source of information with its most reliable use? (2 points)
cladogram → date events which occurred in Earth's past
cladogram → study the evolution of organisms based on adaptations
fossil records → compare the evolution of completely soft-bodied organisms
fossil records → study the behavior of primitive animals in extreme weather conditions
Answer:
petrified fossils → date sedimentary rocks
2 True or False. A projectleie an object that once set in motion continues in motion by its own martia O True False
Answer:
The answer is true.Explanation:PARTICLES MOVING ALONG THE PATH POSSES A TWO DIMENSIONAL MOTIONMARK ME AS BRAINIST PLZ
The following statement is incorrect as stated "Pesticides create pesticide resistance in mosquitoes." Rewrite this sentence so that it is a more accurate statement of what actually occurs when pesticides are used. Why is this concept important to know in trying to control outbreaks of mosquito transmitted diseases such as eastern equine encephalitis (also known as Triple E)?
Answer:
Mosquitoes usually become resistant to pyrethroids through the mutation of a sodium channel gene that controls the movement of ions across cell membranes. Mutations in a single gene are enough to make mosquitoes almost completely resistant to the level of pyrethroids used in insecticides.
The suprachiasmatic nuclei enable the nervous system to respond to daily light/dark alterations through their stimulation of
Answer:
The suprachiasmatic nuclei enable the nervous system to respond to daily light/dark alterations through their stimulation of melatonin.
Explanation:
Melatonin is a hormone produced naturally by the body. Its function is to regulate the body's circadian cycle. This hormone is stimulated and begins to act by changing between a light environment and a dark environment. This stimulation interacts with the suprachiasmatic nuclei making the nervous system understand this change and luminosity of the environment and respond to the action of melatonin.
What are the best management practices for Maize grain crop, by adopting which we can boost yield, elaborate in details your expert opinion.
Answer:
Cultivate prime grain and with timely care
Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!
Complete question:
Use the sequence below to answer the following questions
3’-ACGGATCCTCCCTAGTGCGTAATACG-5’
5’-TGCCTAGGAGGGATCACGCATTATGC-3’
1. Enter the sequence of the coding strand with a 5’-3’ polarity
Answer:
coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´
Explanation:
When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.
The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.
When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.
The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.
Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.
So, in the exposed example we have two strands, but we do not know yet which one is the coding one.
Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.
First-strand:
3’-ACGGATCCTCCCTAGTGCGTAATACG-5’
let us write it is 5´to 3´direction
5´- GCATAATGCGTGATCCCTAGGCA -3´
now let us identify the start and stop codons in 5´⇒3´direction.
Start codon ⇒ ATGStop codon ⇒ TAA, TAG, TGA5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning
5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons
Second strand: We will do exactly the same procedure
5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end
5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning
What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.
So, the sequence of the DNA coding strand with a 5-3 polarity is
5´- GCATAATGCGTGATCCCTAGGCA -3´
What fraction of the progeny of the cross BbTt x BbTt will have black fur and long tails?
A) 0/16
B) 1/16
C) 3/16
D) 9/16
E) 16/16
Answer:
plzzzz upload a full picture
Which of these is a benefit of fish farming?
A. It can deplete native fish populations
B. It can restock lakes depleted by recreational fishing
C. It can pollute natural bodies of water
D. It can pass diseases to native fish populations
Answer:
The answer to this would be B
Explanation:
B:It can restock lakes depleted by recreational fishing
If a diploid cell has 20 chromosomes, how many sister chromatids will be present
during PROPHASE of MITOSIS?
Answer:
92 chromatids
Explanation:
During phosphate, the nuclear envelope of the cell (which is where the 92 chromatids are contained) begins to break down. The centrioles, which are the only present in animal cells, separate and each moves to an opposite end of the cell
do you think there is the roots in utricularia?
Answer:
I think so
Explanation:
sexually produced offspring are indentical to their parent . true or false ?
State three ways of increasing the life-span of cut flowers
Answer:
Clean your vase thoroughly, Keep flowers away from fruit, Flower Food and Water
Explanation:
Which genotype would give you a wild type phenotype?
Answer:
C
Explanation:
animal cell vs plant cell
Answer:
animal cell
Explanation:
What is the term that refers to a deep divide between tissues of the brain?
Gyrus
fissure
sulcus
fusior
Answer:
fissure!
Explanation:
The extinction vortex represents the idea that even if an organism is extant, it may have a gene pool that will not support its long-term survival.A. TrueB. False
Answer:
True.
Explanation:
Extinction vortex is a model used by scientists to understand extinction dynamics within a community. This model allows scientists to assess and understand how a population can become highly vulnerable to elements of its habitat, becoming increasingly apt for extinction. According to this model, any organism is capable of extinction, as all are susceptible to having a gene pool that will not allow its survival, regardless of the environment.
who do study edexcell certificate level? and can help be physics,chemistry and biology exam
I have done GCSE sciences and also applied science a level so I could probably help you :)
Write an experiment to show that sunlight is necessary for photosynthesis.
Answer:
Explanationwe have two or three plants, they both get the same water every day they both get the same amount of soil and fertilizer, one is without sunlight and one is with, after a 2 weeks our results will be found
hope this helps
Most streams result from _____.
a. altitude
b. melted snow
c. oceans
d. rivers
Answer:
....b........ melted snow
why do males and females have different signs and symptoms when it comes to heart attacks
[tex]{\huge{\underline{\sf{\red{Answer}}}}}[/tex]
For men and women, chest pain or discomfort is the most common heart attack symptom, but women are more likely to report shortness of breath, back or jaw pain, and nausea and vomiting. Black women of any age have a higher incidence of heart attacks than white women.
does tomato have thick or thin exocarp?
Given the latitudinal differences in sunlight intensity, how might you expect the carrying capacity of a plant species found at the equator to compare with that of a plant species found at high latitudes? Explain your answer
Answer:
The carrying capacity of a plant species expect in the equator is higher as compared to the carrying capacity at high Latitudes. This is due to the equator the plants have more light available, so the ecosystem can give them better conditions to survive and reproduce. Remembering that the carrying capacity is the largest population size an ecosystem can support without degrading itself, in the equator would be higher as it can have better conditions of light, so they would survive and reproduce more and the largest population the ecosystem could support would be higher.
What is the purpose of a geological time scale ?
It used to predict natural disaters throughout Earth’s history.
It is used to present the correct sequence of events in the Earth’s history.
It is used to determine the absolute dates in years for different periods.
It used to create a naming system for flora and fauna.
Answer: B. It is used to present the correct sequence of events in the Earth’s history.
Explanation: On Edge!!!! :)
Answer:bbbbb
Explanation:
qcw3ec
At a birthday party, a teen decides to inhale some of the helium from a nearby balloon using his mouth. Before the helium gas reaches his right and left lungs, through which order of structures will it flow?
A. Oral cavity to the oropharynx to the trachea to the right and left main bronchi.
B. Oral cavity to the trachea to the trachea to the nasopharynx to the right and left main bronchi.
C. Oral cavity to the right and left main bronchi to the trachea to the oropharynx.
D. Oral cavity to the trachea to the larynx to the right and left main bronchi.
E. Oral cavity to the nasopharynx to the trachea to the right and left main bronchi.
Answer:
D. Oral cavity to the trachea to the larynx to the right and left main bronchi.
Explanation:
The respiratory system may be a system consisting of specific organs and structures used for gas exchange in animals and plants.
What is the process of respiration?We have a pair of external nostrils opening out above the upper lips. It results in a nasal chamber through the nasal passage. The nasal chamber opens into the pharynx, some of which are the common passage for food and air. The pharynx opens through the larynx region into the trachea.Trachea is a straight tube extending up to the mid-thoracic cavity, which divides at the extent of the 5th thoracic vertebra into a right and left primary bronchi. Each terminal bronchiole gives rise to a variety of very thin, irregular-walled, and vascularized bag-like structures called alveoli. The branching network of bronchi, bronchioles, and alveoli comprise the lung.
Thus, we can conclude that the correct option is (e).
The oral cavity to the nasopharynx to the trachea to the right and left main bronchi.
You can learn more about the respiratory system here:
https://brainly.com/question/2619922
#SPJ2
Describe the impact of technology on the environmental today
Explanation:
Other detrimental effects include diseases such as typhoid and cholera, eutrophication and the destruction of ecosystems which negatively affects the food chain. Resource depletion is another negative impact of technology on the environment. It refers to the consumption of a resource faster than it can be replenished
