Differentiate between pathogenicity and hypersensitivity; Also write different methods of inoculating the plants.

Answers

Answer 1

Answer:

As nouns the difference between pathogenesis and pathogenicity. is that pathogenesis is the origin and development of a disease while pathogenicity is the quality or state of being capable of causing disease.


Related Questions

What are the best management practices for Maize grain crop, by adopting which we can boost yield, elaborate in details your expert opinion.

Answers

Answer:

Cultivate prime grain and with timely care

who do study edexcell certificate level? and can help be physics,chemistry and biology exam​

Answers

I have done GCSE sciences and also applied science a level so I could probably help you :)

Write an experiment to show that sunlight is necessary for photosynthesis.

Answers

Answer:

Explanationwe have two or three plants, they both get the same water every day they both get the same amount of soil and fertilizer, one is without sunlight and one is with, after a 2 weeks our results will be found

hope this helps

14.
(GT.03)
Which of these best matches a source of information with its most reliable use? (2 points)


cladogram → date events which occurred in Earth's past

cladogram → study the evolution of organisms based on adaptations

fossil records → compare the evolution of completely soft-bodied organisms

fossil records → study the behavior of primitive animals in extreme weather conditions

Answers

Answer:

petrified fossils → date sedimentary rocks

Should we clone animals that are going or have gone extinct (in other words bring them back
either from the brink of extinction or from extinction)? Explain your answer.

Answers

No, God gives and takes away, the world is heartless and kills entire species to extinction but it’s nothing that God didn’t already know would happen. Dinosaurs are no longer here there extinct for a reason, nowadays extinction comes from man but everything that happens in this world is Already written out in Gods book

Answer:

I think we should but people are preventing this though

Explanation:

I think we should because it might benefit the world and let scientists to discover this animal. But then I don't think so because animals that are/were extinct could perhaps be from climate change. Nowadays, people don't take this matter seriously causing habitats to be destroyed and animals to be extinct :) Like icebergs are melting that mean penguins are at risk of being extinct,if we did something then this situation will be prevented. However dinosaurs did become extinct and they did not come back so its probably just life and this is how god planned it:)

At a birthday party, a teen decides to inhale some of the helium from a nearby balloon using his mouth. Before the helium gas reaches his right and left lungs, through which order of structures will it flow?
A. Oral cavity to the oropharynx to the trachea to the right and left main bronchi.
B. Oral cavity to the trachea to the trachea to the nasopharynx to the right and left main bronchi.
C. Oral cavity to the right and left main bronchi to the trachea to the oropharynx.
D. Oral cavity to the trachea to the larynx to the right and left main bronchi.
E. Oral cavity to the nasopharynx to the trachea to the right and left main bronchi.

Answers

Answer:

D. Oral cavity to the trachea to the larynx to the right and left main bronchi.

Explanation:

The respiratory system may be a system consisting of specific organs and structures used for gas exchange in animals and plants.

What is the process of respiration?

We have a pair of external nostrils opening out above the upper lips. It results in a nasal chamber through the nasal passage. The nasal chamber opens into the pharynx, some of which are the common passage for food and air. The pharynx opens through the larynx region into the trachea.Trachea is a straight tube extending up to the mid-thoracic cavity, which divides at the extent of the 5th thoracic vertebra into a right and left primary bronchi. Each terminal bronchiole gives rise to a variety of very thin, irregular-walled, and vascularized bag-like structures called alveoli. The branching network of bronchi, bronchioles, and alveoli comprise the lung.

Thus, we can conclude that the correct option is (e).

The oral cavity to the nasopharynx to the trachea to the right and left main bronchi.

You can learn more about the respiratory system here:

https://brainly.com/question/2619922

#SPJ2

State three ways of increasing the life-span of cut flowers​

Answers

Answer:

Clean your vase thoroughly, Keep flowers away from fruit, Flower Food and Water

Explanation:

sexually produced offspring are indentical to their parent . true or false ?

Answers

This is true!!!!!!!!!!

Most streams result from _____.
a. altitude
b. melted snow
c. oceans
d. rivers

Answers

Answer:

....b........ melted snow

C because I just took a test like that

2 True or False. A projectleie an object that once set in motion continues in motion by its own martia O True False ​

Answers

Answer:

The answer is true.Explanation:PARTICLES MOVING ALONG THE PATH POSSES A TWO DIMENSIONAL MOTION

MARK ME AS BRAINIST PLZ

Describe the impact of technology on the environmental today

Answers

Explanation:

Other detrimental effects include diseases such as typhoid and cholera, eutrophication and the destruction of ecosystems which negatively affects the food chain. Resource depletion is another negative impact of technology on the environment. It refers to the consumption of a resource faster than it can be replenished

does tomato have thick or thin exocarp?​

Answers

I think it’s thick

Explanation
Here, we describe the simultaneous transcriptome profiling of all five major cell types/tissues of the tomato fruit pericarp (Figure 1), including the outer epidermis (a single cell layer), collenchyma (approximately three to five cell layers in the Ailsa Craig cultivar used in this analysis), parenchyma

The following statement is incorrect as stated "Pesticides create pesticide resistance in mosquitoes." Rewrite this sentence so that it is a more accurate statement of what actually occurs when pesticides are used. Why is this concept important to know in trying to control outbreaks of mosquito transmitted diseases such as eastern equine encephalitis (also known as Triple E)?

Answers

Answer:

Mosquitoes usually become resistant to pyrethroids through the mutation of a sodium channel gene that controls the movement of ions across cell membranes. Mutations in a single gene are enough to make mosquitoes almost completely resistant to the level of pyrethroids used in insecticides.

animal cell vs plant cell

Answers

Answer:

animal cell

Explanation:

Which genotype would give you a wild type phenotype?

Answers

Answer:

C

Explanation:

Which of these is a benefit of fish farming?

A. It can deplete native fish populations


B. It can restock lakes depleted by recreational fishing


C. It can pollute natural bodies of water


D. It can pass diseases to native fish populations

Answers

Answer:

The answer to this would be B

Explanation:

B:It can restock lakes depleted by recreational fishing

Which quantity does a light year measure

Answers

Answer:

distance = 9.46 trillion kilometers

Explanation:

Light years measure distance and is a unit that equals the distance light travels through space in one year on Earth (365 days) and is used as way to measure extremely vast distances in outer space. It equals 9.46 trillion kilometers.

do you think there is the roots in utricularia?​

Answers

Answer:

I think so

Explanation:

How does water relate to the ability of a living thing to generate usuable energy?

Answers

Answer:

Without the proper balance of water, chemical reactions in cells could not take place.

Explanation: :)

The suprachiasmatic nuclei enable the nervous system to respond to daily light/dark alterations through their stimulation of

Answers

Answer:

The suprachiasmatic nuclei enable the nervous system to respond to daily light/dark alterations through their stimulation of melatonin.

Explanation:

Melatonin is a hormone produced naturally by the body. Its function is to regulate the body's circadian cycle. This hormone is stimulated and begins to act by changing between a light environment and a dark environment. This stimulation interacts with the suprachiasmatic nuclei making the nervous system understand this change and luminosity of the environment and respond to the action of melatonin.

If a diploid cell has 20 chromosomes, how many sister chromatids will be present
during PROPHASE of MITOSIS?

Answers

Answer:

92 chromatids

Explanation:

During phosphate, the nuclear envelope of the cell (which is where the 92 chromatids are contained) begins to break down. The centrioles, which are the only present in animal cells, separate and each moves to an opposite end of the cell

What fraction of the progeny of the cross BbTt x BbTt will have black fur and long tails?

A) 0/16

B) 1/16

C) 3/16

D) 9/16

E) 16/16

Answers

Answer:

plzzzz upload a full picture

why do males and females have different signs and symptoms when it comes to heart attacks

Answers

[tex]{\huge{\underline{\sf{\red{Answer}}}}}[/tex]

For men and women, chest pain or discomfort is the most common heart attack symptom, but women are more likely to report shortness of breath, back or jaw pain, and nausea and vomiting. Black women of any age have a higher incidence of heart attacks than white women.

Women are less likely to need stenting to open a blocked artery, but they still suffer blood vessel damage that reduces blood flow to the heart, causing a heart attack.

The extinction vortex represents the idea that even if an organism is extant, it may have a gene pool that will not support its long-term survival.A. TrueB. False

Answers

Answer:

True.

Explanation:

Extinction vortex is a model used by scientists to understand extinction dynamics within a community. This model allows scientists to assess and understand how a population can become highly vulnerable to elements of its habitat, becoming increasingly apt for extinction. According to this model, any organism is capable of extinction, as all are susceptible to having a gene pool that will not allow its survival, regardless of the environment.

What is the purpose of a geological time scale ?

It used to predict natural disaters throughout Earth’s history.
It is used to present the correct sequence of events in the Earth’s history.
It is used to determine the absolute dates in years for different periods.
It used to create a naming system for flora and fauna.

Answers

Answer: B. It is used to present the correct sequence of events in the Earth’s history.

Explanation: On Edge!!!! :)

Answer:bbbbb

Explanation:

qcw3ec

Given the latitudinal differences in sunlight intensity, how might you expect the carrying capacity of a plant species found at the equator to compare with that of a plant species found at high latitudes? Explain your answer

Answers

Answer:

The carrying capacity of a plant species expect in the equator is higher as compared to the carrying capacity at high Latitudes. This is due to the equator the plants have more light available, so the ecosystem can give them better conditions to survive and reproduce. Remembering that the carrying capacity is the largest population size an ecosystem can support without degrading itself, in the equator would be higher as it can have better conditions of light, so they would survive and reproduce more and the largest population the ecosystem could support would be higher.

Consider the following statements:
1. RNA is ribonucleic acid.
2. RNA is used for information transport (known as mRNA). Choose the correct answer from the given codes:
A Only 1
B Only 2
C Both
D Neither 1 nor 2
E None of the above

Answers

Answer:

Only A

Explanation:

RNA is used for storing and transporting information through mostly virus only..

What is the term that refers to a deep divide between tissues of the brain?
Gyrus
fissure
sulcus
fusior

Answers

Answer:

fissure!

Explanation:

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Answers

Complete question:

Use the sequence below to answer the following questions  

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’  

5’-TGCCTAGGAGGGATCACGCATTATGC-3’  

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.  

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.  

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.  

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATGStop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

Help me out with this again, pretty please?

(2nd time)

I need explanation for your answers, even though it's multiple choices, I still need your explanation for it.

DUE TOMORROW!

If your answer is NONSENSE it will be deleted as soon as possible!

But if your answer is CORRECT, HELPFUL, HAS AN EXPLANATION, I'll chose your answer as the BRAINLIEST ANSWER!​

Answers

Answer:

A. atomic number ✅A. groups ✅

Hope this helps!!

Other Questions
Question 7 of 10What did the White League want?A. Young African Americans to act like whitesB. White power and Democratic Party controlC. Cleaner cities in the SouthO D. Money for colleges for young, white women Find the values of x and y. Round your answers to the nearest tenth if necessary, In an experiment the mass of a calorimeter is 36.35 g . Express in micrometer ,millimetre and kg. At which Loint is air pressure lowest?The image shows a representation of mountains ofvarious heights, numbered 1, 2, and 3. The plain islabeled number 4.O 12304 The continental crust covers ____ of the earth's surface a. 40% b. 50% C. 60% d. 70% Which one of the following groups would be unbiased when asked, What is your favorite kind of pizza?Group of answer choiceshealth & fitness fanatics leaving the gymguests leaving a gourmet pizza restaurantkids at the playgroundfamilies attending a sporting event what force to be required to accelerate a car of mass 120 kg from 5 m/s to 25m/s in 2s One of the best sources of precall information is a prospect's own salespeople because they empathize with the salesperson's situation.a. Trueb. False Which experiment would most likely contain experimental bias?Choices see photo What is the simplest form of this expression? Calculate the mass of Na2S needed if a solution containing 2g of Hg(NO3)2 was added to Na2S solution. ( Hg= 200.59, N= 14, O= 16, Na= 23, S=32) HELP ASAP!!!! 50 points!!In this task, youll record the direction of a compass as its placed at different points around a magnet. The investigation will try to answer the question, Do two magnets create magnetic force fields that allow them to interact without touching?Part D : How might someone dispute the results of this investigation? How might you counter the argument? why might the melting point of the crystals obtained in this experiment be close to but below one of the reference melting points and melt slowly over several degrees pls pls helpHow many solutions does the equation 3x + 6 = 1 3 + 4x have? TwoZeroOneInfinitely many The functions f(x) and g(x) are shown on the graph.f(x) = x2What is g(x)?10-If(x)110-5510g(x)-10A. g(x) = ( x)2 - 3B. g(x) = x2 + 3 c. g(x) = (-x)2 + 3D. g(x) = -X2 - 3 What is wage cuts going to do to the American family during the Depression? Compute P(B) using the Classical Method. Round your answer to two decimal places. Mylo is tracking the amount of calories he is consuming each day, along with his amount of exercise. He also takes his basal metabolic rate into consideration, which is 1,780 calories per day. At the end of the first day, he has consumed 2,000 calories in food and beverages and burned 450 calories with intense cardio training, giving him a 230 calorie deficit for the day. What will most likely be the outcome if Mylo continues this pattern for multiple weeks?A. He will gain weight. B. He will lose weight.C. His weight will stay about the same.D. His weight will shift up and down. 62. A chemist mixes 15 liters of 40 percent acid solution and 25 liters of 20 percent acid solution.What percent of the mixture is acid? 1. When did they open the London underground?