During his 1961 62 season, basketball player Wilt Chamberlain scored more than four
thousand points
active voice
passive voice
Submit

Answers

Answer 1

During his 1961-62 season, basketball player Wilt Chamberlain scored more than four  thousand points.

The sentence is in the active voice.

More than four thousand points were scored by basketball player Wilt Chamberlain during his 1961-62 season.

The sentence above is in the passive voice.

Hope it helps. :)

Answer 2

Answer:

This is in Active voice

Explanation:


Related Questions

FFFFFRRRRRRRRRRREEEEEEEEEEEEE PPPPPPPPPPPPPOOOOOOOOOOOOIIIIIIIIIINNNNNNNNNNNNNNNNNTTTTTTTTTTTTSSSSSSSSSSSSSSSSSS FIRST ONE GETS BRAINLIEST

Answers

Answer:

THX GIVE ME

Explanation:

Create your own poem about the hardships of slavery


WITH SIMPLE WORDS PLZ

Answers

Answer:

poem

Explanation:

slavery was not a choice, there was no question on weather to rap3 or get tortured. we cannot get the excact stories of the hardships of slavery, but we will forever know the mystery are unknown....

"That ball 'bolted' by so fast." What does the word 'bolted' mean in this sentence?

Answers

Answer:

It means to run away suddenly or quickly

Answer:

If you're learning about this I'm assuming your professor is also os already has taught you about context clues.

Considering the final sentence, "It was like a lightning strike", you're going to assume since lightning is extremely fast, so is what the word bolted means.

Make an extremely fast action, let's say.

Sorry if I made this more complicated than it had to be, just thought it deserved a valid explanation.

Hope this helped :)

Identify whether the sentence below is a fragment, run-on or a correct sentence.

To become a knight was all that the squire desired to achieve his goal took many years.
A.
Fragment
B.
Run-on
C.
Correct

Answers

Jjjhhhhjhhhhhuuhuuuuhhhhhhhhhhhhhhh B

(100 POINTS AND BRAINLIEST!!!) Write a poem that begins with the line: "I dream a world" and describe the change you hope for in the world. Your poem should rhyme.

Answers

Answer:

'i dream a world' a world of peace'

"and i dream a world, a world with a niece"

"And toys galore in shopping store"

"with rows of candy for our aunt Nandy"

Filled with joy and lots of love'

It makes the world go round if you just give a hug"

Explanation:

This is just an example, use words like this and make them rhyme.

complete the following story​

Answers

Answer:

Explanation:

There are two goats coming from the beach and they have to cross a stream. There is a narrow log that bridges over the stream. The goats stop and think for a while until they come up with a solution. One lies down while the other crosses over it then the first crosses the log over the stream this makes them both happy.

I don't understand why the one has to lay down but, that's what I came up with. Hope this helps:/

Identify whether the sentence below is a fragment, run-on or a correct sentence.

Lasagna, a baked dish, usually consists of layers of boiled lasagna pasta, tomato sauce, cheese, and meat lasagna can also be made with spinach instead of meat.
A.
Fragment
B.
Run-on
C.
Correct

Answers

Answer: B. Run-on

Explanation:

The sentence below is a run-on. Run-on simply means to continue a particular sentence without stopping or for the individual writing to go longer than what is expected.

In the above scenario, there should have been a full-stop after meat. In this case, there was no full stop and this signifies a run-on.

Answer:

Run on

Explanation:

Read the poem by Jamaal May



The boy decides soldiers can no longer be dead,

so he begins to dig.



Graves are shallow enough that, using only his hands,

he quickly finds a limb



buried without a corpse. He brushes dirt away,

slides the arm into a pocket of overalls.



Until all soldiers are found and placed

in seperate ziplock bags,



his fingers rake soil,

churn the dark earth. His brother



finds him afterwards filling a sink to rinse

the crevices and metal joints, worried



he bathes the plastic infantry too carefully.

As if they had families, As if they were men



Respond to the following questions:


How does the poem reflect the speaker’s cultural experience?

Grupo de escolhas da pergunta

A) It reveals how the author sees the dehumanization of soldiers.

B) Peace requires a soldier’s sacrifice.

C) It explains how the soldiers of the time are forced to risk their lives in combat.

D) It describes the soldiers of the time are called to battle for freedom.

Answers

Answer:

B

Explanation:

patriotism to the country filled with loved ones and family that they left behind to fight for their peace

Which of the following words is not a noun?

(A.) New York
(B.) Friend
(C.) Read
(D.) Web site

Answers

Answer:

read

Explanation:

Answer:

Read

Explanation:

Noun = Person / Place / Thing

Title: SMARTPHONES PUT YOUR PRIVACY AT RISK. Answers?

how does the discussion of people’s reliance on smartphones in paragraphs 1-4 contribute to the text?

Answers

Answer:

"It shows how people's reliance on smartphones allows for data to be collected about them." I think

Explanation:

Risk*

Select the correct text in the passage.
Which sentence reflects the theme of magic in this excerpt from “The Story of the Old Man Who Made Withered Trees to Flower” by Yei Theodora Ozaki?

The old man now tucked up his kimono and made ready to climb the tree. Saying “Excuse me,” he took the pot of ashes which he had brought with him, and began to climb the tree, every one watching his movements with great interest.
At last he climbed to the spot where the tree divided into two great branches, and taking up his position here, the old man sat down and scattered the ashes right and left all over the branches and twigs.

Wonderful, indeed, was the result! The withered tree at once burst into full bloom! The Daimio was so transported with joy that he looked as if he would go mad. He rose to his feet and spread out his fan, calling the old man down from the tree.He himself gave the old man a wine cup filled with the best sake, and rewarded him with much silver and gold and many other precious things. The Daimio ordered that henceforth the old man should call himself by the name of Hana-Saka-Jijii, or “The Old Man who makes the Trees to Blossom,” and that henceforth all were to recognize him by this name, and he sent him home with great honor.

Answers

Answer:

At last he climbed to the spot where the tree divided into two great branches, and taking up his position here, the old man sat down and scattered the ashes right and left all over the branches and twigs.

Wonderful, indeed, was the result! The withered tree at once burst into full bloom!

Explanation:

That sentence shows magic

Answer:

At last he climbed to the spot where the tree divided into two great branches, and taking up his position here, the old man sat down and scattered the ashes right and left all over the branches and twigs

How does the description of the Easter Sunday event in "Marian Anderson Sings" differ from the description of the same event in the biography of Marion Anderson?

A. "Marian Anderson Sings" lists the songs that Marian Anderson performed, but the biography does not include this information.

B. "Marian Anderson Sings" includes dialogue while the biography only includes description.

C. "Marian Anderson Sings" describes Mrs. Roosevelt's major role in arranging the event, and the biography states that Mrs. Roosevelt was not very involved.

D. "Marian Anderson Sings" includes the number of attendees while the biography does not address this detail.

Answers

Answer:

"Marian Anderson Sings" includes dialogue while the biography only includes description.

Explanation:

Took test and got it right

Answer:

i think its b

Explanation:

i think its b sorry if im wrong

Change the following sentence into passive form
1. What question did they raise in the discussion?
2. They are going to build that bridge in 2018
3. They used to build houses of wood
4. How many trees can we save for every ton of recycled newsprint ?
5. We can make many things from wood
6. If I were you. I wouldn’t accept his invitation
7. They must do it before I come
8. Where do they keep a large collection of books?
9. They can find the books they want in the library
10. What do they keep a large collection of the books for ?

Thank you very much

Answers

1. What questions were raised in the discussion?
2. That bridge is going to be built in 2018
3. The houses used to be built of wood
4.how many trees can be saved for every ton of recycled newsprint?
5. Many things can be made from wood.
6. This invitation wouldn’t be accepted (by me) if i were you
7. It must be done before i come
8 where is a large collection of books kept?
9. The books they want can be found in the library
10. what is a large collection of hooks kept for?

What are the consequences of Monkeyman's actions?

Answers

Answer:

From Monkeyman's actions at the fight, the narrator sees that it is possible to stand up for what you believe is right and create positive change in those around you.

Explanation:

I hope I have the correct text to answer this :)

Answer:

Look down!! ;)

Explanation:

By the end of the story, he is influenced by Monkeyman's desire to come back to the community after college to make it better, instead of escaping it. From Monkeyman's actions at the fight, the narrator sees that it is possible to stand up for what you believe is right and create positive change in those around you.

Hope this Helps!! ;)

HELPPPPPPPPPPPPPPP!!!!!!!!!!! BRAINLIEST IS ON THE LINE!!!!!!!!!!!!!!!!!
Write a summary for Macbeth Act 1 Scene 2.

Answers

Answer:

In Act 1, Scene 2 of Macbeth, a wounded officer brings King Duncan news of Macbeth's bravery in battle. He talks about how soon after he defeats the Irish rebel Macdonwald, he begins fighting the massive Norwegian army. ... He also tells how the Thane of Cawdor betrayed the King by helping the Norwegian army.

Describe the relationship between trees of the rainforest and the health of animals and humans.

Answers

Answer:

Rainforests are often called the lungs of the planet for their role in absorbing carbon dioxide, a greenhouse gas, and increasing local humidity. Rainforests also stabilize climate, house incredible amounts of plants and wildlife, and produce nourishing rainfall all around the planet.

Explanation:

Hope I helped You

Please help me its due at 3

Answers

The first one will be your answer

Read the excerpt below and answer the question.

authentic record containing it.

Which word is closest in meaning to the word "authentic"?

Answers

Answer:

Explanation:

unaltered

Answer:

Reliable

Explanation:

where can i find audio book for OneThousand and One Arabian Nights by Geraldine McCaughrean


help

Answers

maybe try you tube ?

Answer:

does anyone yk have an Amazon tablet ?

Explanation:

there on their for free

Which set of details would be most appropriate to include in a paper arguing for all-girl and all-boy schools?
• Girls feel less pressure to impress the boys and boys feel less pressure to impress the girls at all-boy or all-girl schools.
• Boys are exposed to fewer people who have different thoughts and beliefs from their own at all-boy schools.
2. • Boys and girls are less prepared to be in college classes together when they have attended an all-boy or all-girl school.
• All-boy and all-girl schools allow kids to be themselves without fear of being made fun of by kids of the opposite gender.
3. It is expensive and wasteful to have parallel programs for males and females.
• All-boy and all-girl schools reinforce traditional and stereotypical gender roles.
4. • Research has shown that boys tend to be more collaborative and less competitive in an all-boy setting.
- Girls are more comfortable taking subjects such as mathematics, advanced sciences, computers and technology, and wood-
working at all-girl schools.
Moi

Answers

Answer:

It is depend on them how they fells

can someone help me understand this better on what she means by this with procedures

Answers

Answer:

Procedures: a series of actions conducted in a certain order or manner.

BRAINLIST PLS!

can you please help me:)​

Answers

Answer:

put a . after game and before it

Put a period after the word game, then proceed to capitalize the word “it”.

Q.Ankit said to Rita, " It is your last chance." 1.Ankit said Rita it is your last chance. 2.Ankit told Rita that it is her last chance. 3.Ankit told Rita that it was her last chance. 4.Ankit told Rita that it was their last chance.

Answers

Answer:

The correct option is:

3. Ankit told Rita that it was her last chance.

Explanation:

This question is about reported speech. When we report what someone has said, it is important to observe a few things.

1. We usually change the verb tense to the past form of the tense used in the original sentence. In this case, the simple present was used. Therefore, the reported version will be in the simple past.

2. The pronouns need to change accordingly. When Ankit said "your", he was talking to Rita. Now that we are reporting what he said, since we are not talking directly to Rita, we should change "your" to "her".

Having that in mind, we can safely make the changes:

Ankit said to Rita, "It is your last chance." - 3. Ankit told Rita that it was her last chance.

why cant you live without your mom

Answers

I can’t live without my mother because she has done a lot for me. First of all, she brought me to this world. Second, she would always be there for me, when I’m sad. My mother is like my best friend. My mom is really special to me. She has a lot of patience to be able to take care of a person like me.

Since she tried blueberry ice cream Black Canary has
refused to eat any other flavor.

Answers

Answer:

taste aversion

Explanation:

What genre is "The reign of Attila the Hun" by Ed Reaves

Answers

Answer:

it would be realistic fiction

Explanation:

Ed Reaves' "The Reign of Attila the Hun" is non-fiction.

Genre refers to the category of literature. In other words, it means the class or style of a literary text.

There are different forms of the genre in literature, depending on the style and form used. A genre can be fiction, nonfiction, folklore, etc. depending on what the text is about and based on. Fiction is when the text talks about imaginary events or things. Nonfiction is based on real-life events or things. Folklore is about tales from legends or stories of traditional beliefs or customs that are passed from past generations to the next and so on. Ed Reaves' "The Reign of Attila the Hun" is based on the real-life story of Attila the Hun and his life. This means that since the story or text is based on a real person, the genre is nonfiction.

Attila's story by Ed Reaves tells us about the Hun's life and how he invaded and captured territories. Though the story was written by someone, the focus or main character is that of a real person. Thus, the genre is nonfiction.

Learn more about genre here:

brainly.com/question/860825

Who were the men who approached Salva’s group? How does Salva know who they are?

Answers

Answer:

The men were Nuer, Salva knows who they are because they shot his Uncle before leaving in response of his Uncle being their rival, the Dinka.

5. What does Malcolm say is his
first big step toward
self-degradation? What is the
ultimate motivation behind getting
a conk?
Help please Malcolm x.

Answers

He finds very painful associated the conk with self-debasement because African American people endure pain to meet white beauty standards. He finds it degrading that they destroy their Bodies to try to look like whites and in the progress .

What is the effect of the exposition on "President Cleveland, Where Are You?"?

It describes Jerry's intense interest in collecting cowboy cards.

It provides detailed background information about the people in Jerry's family.

It is the point when Jerry begins to consider other people's needs before his own.

It explains how Rollie Tremaine helps Jerry do something kind for Armand.

Answers

Explanation: explanation

Describe the events that lead to Barty Gunliffe's accident

Answers

One day there is a storm, and Barty gets in trouble because he is precariously perched on the rocks during the raging storm. ... Mally's grandfather was right, and the Gunliffes assumed his accident was caused by Mally in an attempt to murder Barty, presumably for gathering seaweed in Malachi's Cove.
Other Questions
Translate these sentences/words in Spanish please1.How are you2. I need to go to the store3. Mother4. Talkative 5. Its freezing to death in my house6. Online7. Go to the movies with a friend8. Charger Names and places in Spanish down below;9.Olive10.Walmart 11.School 12.Holly 13.Crystal happy new year. eeeeeeeee e Simplify 5(x - 2) - 3x + 7.A. 8x - 3B. -10x + 25C. 2x-5D. 2x - 3 I need help ASAP please Which sentence is best structured to present two ideas of equal importance?A. Since NASA was founded, it has sent more than 250 astronautsinto space.B. The mission of NASA is to explore outer space.C. Some people think that NASA should focus on exploring theuniverse, but others believe that building a colony on the moon isthe most important goal, even though it will be difficult.D. NASA is known for sending humans to the moon, but the famousspace program has also sent an unmanned spaceship to Mars. DETERMINE THE MISSING SIDE Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT What caused the original creation of the Universe? How do we find out? Create a flow chart that shows the hierarchy of the US Banking Systems. which is the correct graph for the equation? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA MR. ARCEO TAKES A TAXI FROM THE AIRPORT TO A HOTEL. THE TAXI CHARGES $2.50 INITIAL CHARGE PLUS $2.65 PER MILE. WHICH EQUATION CAN BE USED TO FIND Y, THE TOTAL COST OF THE TRIP, IF X REPRESENTS THE NUMBER OF MILES OF THE TRIP? Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia List two equivalent numbers to 0.50 Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make? You know I never approved of it, pursued Utterson, ruthlessly disregarding the fresh topic.My will? Yes, certainly, I know that, said the doctor, a trifle sharply. You have told me so.Well, I tell you so again, continued the lawyer. I have been learning something of young Hyde.The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. I do not care to hear more, said he. This is a matter I thought we had agreed to drop.The Strange Case of Dr. Jekyll and Mr. Hyde,Robert Louis StevensonWhere in the plot is this passage found?the expositionthe rising actionthe falling actionthe resolution