Explain the supercontinent cycle in your own words.

Answers

Answer 1

Answer: The supercontinent cycle is the quasi-periodic collection and dispersal of Earth's continental crust. There are different theories as to whether the volume of continental crust is rising, fading, or lingering about the same, but it is accepted that the Earth's crust is constantly moving.


Related Questions

How do B cells know when to make antibodies?

A.) They are alerted by Helper T cells.

B.) They are always making antibodies just in case that pathogen is present.

C.) They are alerted by Macrophages.

D.) B cells will simply find the pathogen in the body and immediately begin making
antibodies to fight the pathogen.

Answers

Answer:

A) They are alerted by Helper T cells.

Which of the following is not a benefit to humans from biodiversity?

A. Many medications are made from living organisms

B. Enjoyment from recreational activities

C. We have a variety of products produced for clothing, food, and other items

D. The weather is more comfortable

Answers

For me it's letter A.

Because B and C and D are benefits of biodiversity....So that's why,for me it's letter A.

Well,don't trust me if you don't want to

Genetic information is stored and transmitted within.
A. nucleic acids.
B. proteins.
C. amino acids.
D. sugars.

Answers

Answer:

A. nucleic acids

Answer:

A. nucleic acids

Explanation:

plz help me on science due today

Answers

Answer:

A

Explanation:

Wind is caused by inequal heating. As you should have learned, things expand when they get hot and contract when they get cold. So, the high pressure hot air flows into the low pressure cold air via wind.

Recycling of car batteries can help to do what to lead?​

Answers

Thanks to recycling, we barely mine lead any more. An estimated 85 percent of lead in use today goes into batteries, mostly for automobiles. And when the batteries run down, 99 percent of this lead is recycled to make new batteries.

Please help me, I really need help with this.

Answers

what do you need help with ?

In order for a neuron to receive and transmit a message it must be in a polarized state. While in this rest state there are more sodium ions outside the cell membrane while potassium is prevalent inside the cell. This causes the neuron to maintain a neutral charge. Once the action potential arrives at its [ Select ] , a nerve cell will shuttle the message down its own axon and to the next neuron via its [ Select ] . This impulse will cause the cell to become [ Select ] and will effectively change the charge of the neuron to a [ Select ] charge. After sodium rushes into the cell, the potassium will rush out in order to [ Select ] . Once the impulse reaches the axon terminal, it is [ Select ] that stimulates a [ Select ] to continue the message to the next neuron. The neuron then undergoes a [ Select ] when all ions are repositioned with help of the

Answers

Answer:

The process of nerve impulse transmission by means of an action potential involves the processes of depolarization, repolarization, hyperpolarization and restoration of resting memebrane potential.

Explanation:

In order for a neuron to receive and transmit a message it must be in a polarized state. While in this rest state there are more sodium ions outside the cell membrane while potassium is prevalent inside the cell. This causes the neuron to maintain a neutral charge. Once the action potential arrives at its dendrites, a nerve cell will shuttle the message down its own axon and to the next neuron via its axon terminal. This impulse will cause the cell to become depolarized and will effectively change the charge of the neuron to a poositive charge. After sodium rushes into the cell, the potassium will rush out in order to restore its resting memebrane potential. Once the impulse reaches the axon terminal, it is used to open voltage- gated calcium channels releasing calcium ions that stimulates a neurotransmitter to continue the message to the next neuron. The neuron then undergoes a repolarisation when all ions are repositioned with help of the voltage-gated ion channels.

Having trouble with this textbook question. Can anyone help me out?
"You learned that the length of the cell cycle varies between cell types. Predict which of the three phases of the cell cycle varies"

Answers

Answer:

Oh well Thx that could really help

help asap please!
science
Complete the table below to show the difference between active and passive transport. Put a “X” in boxes that satisfy the statement.

Answers

Answer:

Active transport:

requires energymolecules move from low to high concentration sidesNa+ and K+ move by active transport

Simple diffusion:

molecules move from high to low concentration sidesmolecules pass between lipids small non-polar and polar molecules

Facilitated diffusion:

molecules move from high to low concentration sidesinvolves channel proteinsmove large molecules

Explanation:  

Simple Diffusion is the pathway of only small molecules that freely move through the membrane by momentary openings produced by the lipids' movements. Diffusion is a slow process that requires short distances and pronounced concentration gradients to be efficient. An example of diffusion is osmosis by which water is the transported molecule. Facilitated diffusion is the transport of hydrophilic molecules that can not freely cross the membrane. Channel protein and many carrier proteins are in charge of this transport. When uncharged molecules cross the membrane, they do it according to their concentration gradients, going from the more concentrated side to the lower concentrated one. When ions need to cross the membrane, the process depends on an electrochemical gradient.  Glucose is an example of a hydrophilic protein that gets into the cell by facilitated diffusion.

Simple diffusion and facilitated diffusion are both passive transport processes because they only depend on electrochemical gradients, so they do not need any energy to occur.

Active transport is the transport of molecules that move against the electrochemical gradient, so it does need energy to happen. Molecules move from the lower concentration side to the higher concentration side of the membrane. Carrier proteins are in charge of active transport. The needed energy might proceed from the ATP molecules or the membrane's electric potential. An example of molecules moved by active transport are the Na and K.

In Active transport, molecules or ions move against the concentration gradient by using energy from ATP.

What is Membrane transport?

The transfer of molecules across the plasma membrane into or out of the cell.

There are two types of membrane transport,

1. Passive transport:

When molecules move along the gradient. It can be of two types,

Simple diffusion (via phospholipids)Facilitated diffusion (via channel protein)

2. Active transport:

When molecules move against the concentration gradient, they require energy. Energy is given by ATP.

Therefore, in Active transport, molecules or ions move against the concentration gradient by using energy from ATP.

Learn more about Membrane transport:

https://brainly.com/question/13220002

What is the function of the DNA

Answers

Answer:the function is direction to build life

Explanation: i’m smart

Answer:

DNA is a information molecules.

It stores instructions for making other large molecules called proteins

these instructions are stored inside each of our cell.

distribution among 46 long structure called chromosomes

limestone can be a very jointed type of rock. which drainage pattern would you expect to see as a result

Answers

The answer is Trellis

The drainage pattern one is expected to see in the limestone is trellis. The correct option is C.

What are trellis drainage pattern?

Trellis drainage patterns form when sedimentary rocks like limestone are rolled up or slanted and then stripped away to varying degrees depending on their strength.

The Rocky Mountains of British Columbia and Alberta are prime examples of this, with trellis patterns found in many of the drainage systems.

Thus, the correct option is C.

For more details regarding trellis drainage pattern, visit:

https://brainly.com/question/13020553

#SPJ2

The missing options of the question are:

A. DendriticB. RadialC. TrellisD. Rectangular

AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash.

Answers

Answer:

what?

Explanation:

The ATP produced by a plant cell is made in the process of CELLULAR RESPIRATION which occurs in the
A. endoplasmic reticulum.

B. ribosomes.

C. mitochondria.

Answers

Answer:

Mitochondria

Explanation:

Answer:

C

Explanation:

As mitochondria is the power house of plant cell.

helpppppp pleaseeeeeee

Answers

adaptations shouldn’t end up causing difficulties for the animal so that eliminates options A and D. Option B can be eliminated because a long beak more than likely wouldn’t help a bird hide from predators, if anything it could make it stand out more. So, the answer is C

Which species has the MOST RECENT common ancestor with the ROBIN?
Hagfish
(outgroup)
Salmon
Jaws
Frog
Keratinous
scales
Lizard
Lungs:
Four limbs
Alligator
D
Gizzard
Feathers
Claws
Robin
or nails
G
Rat
Fur;
Mammary
Glands
Gorilla
Time
O Lizard
O Salmon
O Gorilla

Answers

Answer is lizard :)!

Does grain size determine the porosity of a sediment type?

Answers

Answer:

Yes

Explanation:

In sediments or sedimentary rocks the porosity depends on grain size, the shapes of the grains, and the degree of sorting, and the degree of cementation. Well-rounded coarse-grained sediments usually have higher porosity than fine-grained sediments, because the grains do not fit together well

Why would breeders want to introduce mutations into a population?Single line text.

Short answers please

Answers

Answer:

Breeders can increase the genetic variation in a population by inducing mutations, which are the ultimate source of genetic variability

what happens to macromolecules from food during digestion?
what atoms makeup sugar molecules, amino acids, and fatty acids?
what do you notice about the atoms that make up these molecules?
how are these atoms used to make new molecules? what types of molecules are made?
where does the energy come from to produce these new molecules?

Answers

Answer:

In chemical digestion, enzymes break down food into the small molecules the body can use. It is important to break down macromolecules into smaller fragments that are of suitable size for absorption across cell membranes.

Amino acids are the monomers that makes up protein

If it's in the table, it's an element! Atoms can join together - they form bonds together - to make MOLECULES. For example, two atoms of hydrogen hook together to form a molecule of hydrogen, H2 for short.

BONDING. When atoms join together to form molecules, they are held together by chemical bonds. These bonds form as a result of the sharing or exchange of electrons between the atoms. ... Different atoms use these electrons to form one of three different types of bond: ionic bonds, covalent bonds, or metallic bonds.

Proteins. ...

Lipids. ...

Carbohydrates. ...

Nucleic Acids.

Respiration, which consists of three phases, occurs in the mitochondria, the cell's “powerhouses.” This metabolic pathway traps the maximum amount of stored chemical energy within a molecule of glucose, generating a total of 30 molecules of ATP in conjunction with glycolysis.

Please give me a brainliest...Thank you

Please help me. Thank you :()

Answers

1. Complete dominance
2. Incomplete dominance
3. Codominance

Rocky's class recently got pet turtles. When putting together the habitat, decomposers were added to
the soil, as well as some smaller organisms that turtles eat. Some students wanted to get "fake" plants
for the terrarium, but Rocky insisted that this would negatively affect the carbon and oxygen cycles.
Which of the following reasons support why Rocky is correct?
Carbon won't be removed from the air.
Photosynthesis won't occur.
The turtles won't be able to breathe.
All of these are correct.

Answers

I’m feeling that it’s D.

Answer:

D. all of these are correct

Explanation:

I so sorry if I am wrong the answer

In subduction what plate would be on top and what plate would be on the bottom?

Answers

Answer:

oceanic plate would slide under the continental plate

Explanation:

continental is on top, oceanic on bottom

Answer:

When an oceanic lithosphere meets a continental lithosphere in a subduction zone, the oceanic plate always goes under the continental plate. This is the rule because the rock making up an oceanic lithosphere is denser than in a continental lithosphere.२०२० मे

Protein in your diet provide what necessary substances to repair muscles?

Answers

The muscle damage initiates a repair process in which certain hormones, along with the macronutrient protein, synthesize new satellite cells, which are used to repair the damaged muscle fibers. In other words, the role of protein is to help repair tissues damaged by exercise.

necesito hacer una infografia en mi computadora y nose como pueden ayudarme

Answers

Answer:

Identify the audience for your infographic.

Collect your content and relevant data.

Choose your desired infographic template.

Download your template to PowerPoint.

Customize your infographic.

Include a footer with your sources and logo.

Add an embed code and Pinterest button, and publish it.

Explanation:

How does carbon move from the nonliving (abiotic) environment into the living (biotic) environment?

A.) fossil fuels take carbon dioxide out of the air
B.) plants take carbon dioxide from the air
C.) animals take carbon dioxide from the air
D.) carbon dioxide moves from the air into water

Plz help soon i'll mark brainliest

Answers

Answer:

b plants take carbon dioxide from the air

Which group of pictures best represents a population?
А.
В.
C.
D

Answers

Answer:

C

Explanation:

because a population is a group of the same species that lives in a given area

Choose the mutation that you think has caused Calix’s calico fur coloring. Form a hypothesis to explain your reasoning. You will be able to revise your hypothesis as you collect more data. ( Ya'll i need a hypothesis )

Answers

The complete question is as follows:

Hypothesis Cas More Information: Here is a summary of the data, Mass of DNA Cat Res per Coll Mother Father Calix 1520 fg 1495 fg 1535 fg . The mass of an X chromosome is 40 fg. • Point mutations do not change the mass of DNA. • In chromosomal rearrangement, some daughter cells gain parts of chromosomes and some lose parts of chromosomes. • In nondisjunction, daughter cells gain a whole entire chromosome. Obe Exp Нур 는 Exp Point Mutation in Melosis Chromosomal Rearrangement Nondisjunction Choose the mutation that you think has caused Calix's calico fur coloring. Form a hypothesis to explain your reasoning. You will be able to revise your hypothesis as you collect more data.

Answer:

The correct answer is - non-disjunction.

Explanation:

Calix's calico has an X chromosome gene that determines the color of fur. One allele forms orange fur and the other give rise to black. In heterozygous give rise to orange patches on black.

Mother has autosome and 2-X chromosomes.

Mass of 2 X chromosomes will be

= 40*2

= 80fg

So mass of autosomes = 1520-80

= 1440fg

Mass of sex chromosomes in father is = 1495-1440

= 55fg

So the mass of Y=55-40

= 15fg

It is clear that the mass of DNA of Calix is exactly 15 more than DNA of the mother. So we can say that Calix has an entire Y chromosome in extra.

So the answer is non-disjunction.

The right option is - non-disjunction.

Information regarding Calix’s calico:

It comprises of X chromosome gene that measured the fur color. In the case of heterozygous, it provides the increment with respect to orange that patches on black.

Since Mother has autosome and 2-X chromosomes.

So,

Mass of 2 X chromosomes should be

= 40*2

= 80fg

Now

The mass of autosomes should be

= 1520 - 80

= 1440fg

Now

Mass of s-ex chromosomes in father should be

= 1495-1440

= 55fg

Now finally the mass of Y is

= 55 - 40

= 15fg

Based on the above calculation, the mass of DNA of Calix should be 15 i.e. more than the DNA of the mother.

Learn more about the mutation here: https://brainly.com/question/8334911

An airplane flies from Minneapolis to Chicago in 62 minutes.
If it is 572,000 meters from Minneapolis to Chicago, what is the plane's average speed?
A. 2,000 m/s
B. 355 m/s
C. 154 m/s
D. 119 m/s

Answers

Answer:

154m/s

Explanation:

Average speed= distance(m)/time(sec)

Distance=572,000metres

Time=62×60=3720seconds

As=572000/3720=153.76aproximately154m/s

Summarize the differences between early succession, mid-succession, and late succession?

Answers

On primary succession newly exposed or newly formed rock is colonized by living things for the first time. And in secondary succession an area that was previously occupied by living things

What is molting????????

Answers

A dragonfly in its radical final moult, metamorphosing from an aquatic nymph to a winged adult.

In biology, moulting (British English), or molting (American English), also known as sloughing, shedding, or in many invertebrates, ecdysis, is the manner in which an animal routinely casts off a part of its body (often, but not always, an outer layer or covering), either at specific times of the year, or at specific points in its life cycle.

Moulting can involve shedding the epidermis (skin), pelage (hair, feathers, fur, wool), or other external layer. In some groups, other body parts may be shed, for example, wings in some insects or the entire exoskeleton in arthropods.

Negative feedback loops:
a. decrease rate
b. increase rate
c. reverse change
d. reinforce change

Answers

Answer:

the answer would be c

Explanation:

hope it helped

Other Questions
mga bagay na nasunod nga may pag galang which one A? B? C? D? Select the correct answer.What type of report analyzes evidence and most likely would be used in a criminal case? A incident reportB. forensic reportC recommendation reportD scientific lab report Plz help me well mark brainliest if correct! Someone answer this please help me please:)i really need it The first battle of the Civil War was fought at Fort Sumter in Charleston, South Carolina, in April 1861. Place the events from April 1861 in order. Maria deposits $1,950 into a savings account that earns simple interest at a rate of 3%. She makes no withdrawals. How much interest has Marias account earned after 4 years? Read this excerpt from the speech "Cause of the Great War" delivered by British Prime Minister David Lloyd George after World War I. Which statement accurately describes the use of rhetorical devices in this excerpt? We begged Germany not to attack Belgium, and produced a treaty, signed by the King of Prussia, as well as the King of England, pledging himself to protect Belgium against an invader, and we said, "If you invade Belgium we shall have no alternative but to defend it." The enemy invaded Belgium, and now they say, "Why, forsooth, you, England, provoked this war." It is not quite the story of the wolf and the lamb. I will tell you why because Germany expected to find a lamb and found a lion. 50 POINTS!! What is one advantage of a direct democracy?Decision making can be slow since many people's views must be heard.No one person has all the power, so poor or selfish decisions are less likely to be madeby the governments.Every citizen has the right to vote on issues.All groups in a country are represented when decisions are made. whatis added to make RNA? Carl ordered a refrigerator that weighs 192 pounds. It was shipped to him inside a box andsurrounded by packaging material. The total weight of the refrigerator, box, and packagingmaterial was 205 pounds.What is the weight of the box and packaging material?Enter your answer in the box.pounds On Tuesday the train journey took 7 hours and 20 minutes and began at 13 53. (i) At what time did the train journey end? [1] (ii) Tuesday's time of 7 hours 20 minutes was 10% more than Monday's journey time. How many minutes longer was Tuesday's journey? Which is the best way to improve your earnings?using them all so you don't have to keep up with thembetter educationbuying your needs and wantsbudgeting wisely see image for question Please please hhhheeelllpppIn Platos Allegory of the Cave, he defines education as the turning around of the soul. What does he mean and how does this allow us to think about our personal process of learning? In other words, what is education according to Plato? You might want to think about the education you need for a job, and one that you need for life. What are the opposites of 5, 3.4, 3.35, and 9 1 3 ? Enter the answers in respective order, each separated by comma. Find the perimeter of the figure. At Silver Gym, membership is $30 per month, and personal training sessions are $45 each. At Fit Factor,membership is $90 per month, and personal training sessions are $35 each. In one month, how manypersonal training sessions would Sarah have to buy to make the total cost at the two gyms equal?Sarah would have to buyequal.personal training sessions to make the total cost at the two gyms I need help please (25 points)