HELPPPPPPPP ijendhebfuhrbfrefernf

HELPPPPPPPP Ijendhebfuhrbfrefernf

Answers

Answer 1

Answer:

መልሱ 78 ይሆናል ግን የጎደለው መላምት ፍጥነት ነው

Step-by-step explanation:


Related Questions

Shelly has a bag containing three balls : one red, one yellow, and one green. All balls are likely to be chosen. Shelly will choose one ball without looking in the bag. What is the probability that Shelly will choose the yellow ball out of the bag?

A. 3/3
B. 3/1
C. 1/3
D. 2/3

Answers

The answer is c. Since she has three balls and she is going to chose one is will be 1/3
Hope this helps
C. She has three balls total

The depth y (in inches) of a lake after x years is represented by the equation y=0.2x+42. How much does the depth of the lake increase in four years?

Answers

42.8 in
Step-by-step explanation:
Step one:
given data
we are told that the expression for the depth of a lake after x years is given by

Required
The value of y when x= 4
Step two:
substitute the value of x in the expression to get y

After 4 years the depth will increase by 42.8 in

If the original lengths are multiplied by 2, what are the new coordinates?

Answers

Answer:

Find an answer to your question If the original lengths are multiplied by 2, what is the new coordinate of point A? Assume that the point at (0,0) ...

Step-by-step explanation:

Find the sales tax....

Answers

Answer:8.75

Step-by-step explanation:

helppppp!
need helpp

Answers

1) 3a+2
2) 3c+6
3)-3z

Plz help quickly i need this by today at 9 or I'm grounded. if the doc doesn't work, use the picture i put with it. Or just use the picture at first. 16 points. 24 if brainliest and i will give it to the first person with correct answers. I NEED ALL ANSWERS AND PLZ DONT ANSWER FOR THE POINTS I WILL REPORT YOU.

Answers

Answer:

Part a: 123

Part b: C

1. F(x)=4(2)1

2. F(x)= -4(2)1

3. F(x)=21

4. F(x)=-21

Last is B

Step-by-step explanation: hope this help

What is the Meaning of P
P - 6 = -5

Answers

Answer:

1 is the answer your looking for considering 1 - 6 = -5

Answer:

P = 1

Step-by-step explanation

You have to add 6 on -6 and -5 to make P alone

P - 6 = -5

   +6   +6

P = 1

There is the meaning of P

How can you figure out the diameter of a circle when you just know the area of the circle?
(Please answer in the simplest way) Thanks!

Answers

Answer:

yes

Step-by-step explanation:

If you have the area you can divide it by pi to get r squared. You square root this to get r and then just times your answer by 2. (r is the radius)

what is the distance between these numbers TOGETHER

Answers

Answer:

1 photo = 6 units

2 photo = 5 units

3 photo = 2 units

4 photo = 3 units

Step-by-step explanation:

It's Ez

Evaluate when e=3 and k =200

15 + (k - 45e)

a 215
b 80
c 65

Answers

the answer is b.80. You plug in 200 for k and plug in 3 for e. 45x3=135, 200-135=65, 65+15=80
I think the correct answer is B

please answer right ill give brainliest

Answers

Answer:

20 songs

Step-by-step explanation:

she starts with 20 songs at beginning of year

Joey bought a dozen oranges for $3.50 and several bananas for $0.25 each at the grocery store. Joey spent a total of $5.75 on the fruit. Which number line best represents the number of bananas Joey purchased?
F.

G.

H.

J.

Answers

Answer:

I don't see any number lines...

Step-by-step explanation:

Answer:

wheres the number lines

Step-by-step explanation:

If 1/4 of a number is 5 less than 2/3 of the same number, what is the number?

Answers

Answer:

12

Step-by-step explanation:

x/4 = (2x/3) - 5. Solve for x

-5x/12 = -5

-5x = -60

x = 12

x/4=(2x/3)-5. Solve for x -5x/12= -5 -5= -60 x=12

I need help ASAP

Brian has 5 marbles, Sarah has 9 marbles, Jimi has 4 marbles, and Juan has 6 marbles. They want to redistribute the marbles so that each person has the same number of marbles. If the marbles are redistributed, then how many should each person get?

Answers

Answer:

Answer is

(5 + 9 + 4 + 6)/4

= 24 / 4

= 6

Answer:

6

Step-by-step explanation:

5+4+9+6

9+15

24

24÷4=6

Help please it is graphing

Answers

Here are the pairs:

(from the left)

First group: 3rd graph, y = x - 2, table g

Second group: 2nd graph, y = 2x, table b

Third group: 1st graph, y = x + 2, table m

A group of 80 students was asked to share how they get to school most of the time. The following circle graph represents their answers to the question. How many of the students walk to school most days?

0
24
20
25

Answers

It is 24 because of the days

The graph shows the number of sprays an automatic air freshener dispenses, y, in x minutes

Which expression can be used to calculate the rate per minute at which the air freshener dispenses sprays?

A) 30 over 6
B) 24 over 30
C) 30 over 24
D) 6 over 30

Answers

Answer:

A) 30 over 6

Step-by-step explanation:

Answer: A) 30 over 6

Lee is sewing vests using 16 green buttons and 40 blue buttons. All vests are identical, and all have both green and blue buttons. What are the possible numbers of vests Lee can make? What is the greatest number of vests Lee can make?

Answers

Answer:

You can make 8 vests and each one will have 2 green buttons and 3 blue buttons (16/8=2 and 24/8=3)

Step-by-step explanation:

the GCF of 16 and 24 is (2*2*2*2 and 2*2*2*3) 2*2*2=8

Which statements about experimental probability are true?

O Experimental probability is written as a ratio.

O Experimental probability includes the number of possible outcomes.

O Experimental probability is found by conducting trials of an experiment.

O Experimental probability includes the number of times an event occurs in the numerator, and the total number of trials in the denominator.

O Experimental probability includes the number of times an event occurs in the denominator, and the total number of trials in the numerator.

Answers

Answer:

A

C

D

Step-by-step explanation:

A. C. And D. Sksksdkdbdjskshsjskd

01:52:06
Which best describes the solution to 4 minus 7?
Because Negative 4 + (negative 7) is an equivalent expression, the answer is –11.
Because 4 + (negative 7) is an equivalent expression, the answer is –3.
Because 4 + (negative 7)is an equivalent expression, the answer is –11.
Because Negative 4 + (negative 7) is an equivalent expression, the answer is –3.

Answers

Answer: 4 + (negative 7) is an equivalent expression, the answer is –11.

Step-by-step explanation: I did it on edenuity

Answer:

Because 4 + (negative 7) is an equivalent expression, the answer is –3.

Step-by-step explanation:

I did on the quiz myself sorry i am late please mark brainly.

A function is represented by the graph.

Complete the statement by selecting from the drop-down menu.

The y-intercept of the function​ ​y=−12x+8​ ​​is
Choose...
A Greater than
B Less than
C Equal to
the y-intercept of the function represented in the graph.

Answers

Answer:

I'm not sure but less than I think, I haven't done that in a while so I cant remember

Answer: I think it is less then

Step-by-step explanation:

Sorry if I’m wrong

Solve the problems

9^2

4^3

3^2

2^3

5^2

Answers

Answer:

81649825

Step-by-step explanation:

hope this helps!

Find the percent of the number.

50% of 70 is
.

Question 2
Explain your method.

Answers

Answer:

35

Step-by-step explanation:

Using proportions, you are correct:

70/x = 100/50

cross multiply

100x = 3500

divide both sides by 100 to get your answer.

35 because 70\2= 35.

Which of the following equations do not represent a proportional relationship? y = 4/3x y = 2x - 1 y = x y = 1.4x

Answers

Answer:

y = 2x - 1

Step-by-step explanation:

y = 2x - 1 wouldn't be a proportional relationship. You can tell because any equation with addition or subtraction is not going to be proportional.

Answer:

y=2x-1

Step-by-step explanation:

notice how the second option, y=2x-1 is the only option that has a constant. All other options only have a coefficient on the x term. This makes it perfectly proportional by the factor of the coefficient.

Two hot air balloons are traveling along the same path away from a town, beginning from different locations at the same time. Henry's balloon starts 10 miles from the town and is 24 miles from the town after 2 hours. The distance of Tasha's balloon from the town is represented by the function y=6x+14.

A. Tasha's balloon was farther from the town at the beginning and it traveled more quickly.
B. Henry's balloon was farther from the town at the beginning and it traveled more quickly.
C. Tasha's balloon was farther from the town at the beginning but, Henry's balloon traveled more quickly.
D. Henry's balloon was farther from the town at the beginning but, Tasha's balloon traveled more quickly.

Answers

Answer:

C. Tasha's balloon was farther from the town at the beginning but, Henry's balloon traveled more quickly.

Step-by-step explanation:

Brainliest please I really want to rank up

The answer is c hopes this helps I had the same question

c÷2 when c=26
help me, please

Answers

Answer:

the answer would be 13

Step-by-step explanation:

26/2=13

Answer:

13

Step-by-step explanation:

ita just 26  divided by 2. Hope this helps :)

Awarding brainliest again!!!!

Answers

Answer:

0 = 4

Step-by-step explanation:

Add two to both sides of the equation:

0=4
credits to the other person above me!

State whether the number is a solution to the giving inequality.

x is greater than < or equal to -17; -14

Answers

yes -14 is greater than -17
-14 is greater than -17

Gavin saved $30,000 in a savings account. He received a 2.5% interest rate and saved for 8 years. How much interest did he earn

Answers

he earned 6000 interest in total 36000

Answer:

30000/40=750x8=$6000 in interest earned

Step-by-step explanation:

awarding brainliest!!!

Answers

Answer:

[tex]m=3[/tex]

Step-by-step explanation:

[tex]6m+5-3m=7(m-1)[/tex]

Combine like terms

[tex]3m+5=7(m-1)[/tex]

Distribute the 7

[tex]3m+5=7m-7[/tex]

Subtract 3m from each side

[tex]4m-7=5[/tex]

Add 7 to each side

[tex]4m=12[/tex]

Divide by 4

[tex]m=3[/tex]

6m+5-3m=7(m-1)
3m+5=7m-7
4m=12
m=3
Other Questions
The Venn diagram below shows some of the services provided by national and state governments.Which service completes the Venn diagram? (3 points)A. Raise and collect taxesB. Declare war and make peaceC. Make marriage lawsD, Coin and print money I need a speech written about a president please put it down here Solve: 68 x = 14 ( please i really need these super fast thank you! ) Translate these sentences/words in Spanish please1.How are you2. I need to go to the store3. Mother4. Talkative 5. Its freezing to death in my house6. Online7. Go to the movies with a friend8. Charger Names and places in Spanish down below;9.Olive10.Walmart 11.School 12.Holly 13.Crystal happy new year. eeeeeeeee e Simplify 5(x - 2) - 3x + 7.A. 8x - 3B. -10x + 25C. 2x-5D. 2x - 3 I need help ASAP please Which sentence is best structured to present two ideas of equal importance?A. Since NASA was founded, it has sent more than 250 astronautsinto space.B. The mission of NASA is to explore outer space.C. Some people think that NASA should focus on exploring theuniverse, but others believe that building a colony on the moon isthe most important goal, even though it will be difficult.D. NASA is known for sending humans to the moon, but the famousspace program has also sent an unmanned spaceship to Mars. DETERMINE THE MISSING SIDE Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT What caused the original creation of the Universe? How do we find out? Create a flow chart that shows the hierarchy of the US Banking Systems. which is the correct graph for the equation? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia List two equivalent numbers to 0.50