I need help with all the questions and filling out the punnet square

Answer:

B. DENSITY INDEPENDENT

Explanation:

Density independent is a limiting factor. It affect birth and death rates of organisms through abiotic and environmental factors. A forest fire is one of the environmental factors that affects the density of a species in a given location.

In a starch molecule, the energy is stored in the bonds between atoms, and the building blocks of this molecule are simple sugars.

Starch is a carbohydrate and a polysaccharide, this means this molecule is composed of dozens of glucose molecules that have formed a chain and it is used by organisms, especially plants to store energy.

In other words, starch is the result of glucose molecules forming a chain, and glucose is considered a simple sugar. Therefore, starch is made up of simple sugars.

On the other hand, the energy in starch can be found in the bonds between atoms. This implies once the bonds between atoms break energy is released, and this energy is used by organisms for multiple activities.

Learn more about molecule in: https://brainly.com/question/19922822

Answer:

1) GPP is the energy spent staying alive

Explanation:

Gross primary productivity is the energy that is spent by the organism to staying alive because energy is required by the organism for doing activities that is necessary for the survival. Gross primary productivity refers as the rate at which solar energy is captured in sugar molecules during the process of  photosynthesis. Producers such as plants use some of this energy for metabolism and cellular respiration as well as some for growth and building tissues.

Answer: The right lung is shorter and wider than the left lung, and the left lung occupies a smaller volume than the right.

The lung houses structures of both the conducting and respiratory zones.

The left lung consists of three lobes.

The lungs exchange respiratory gases across a very large epithelial surface area—about 70 square meters

Explanation:

Answer:

the company has also announced plans

Answer:

3) passive transport

Explanation:

Passive transport is a type of cellular transport that does not require the use of energy to move substances (i.e., ions and molecules) across biological membranes. Passive transport uses concentration gradients to move substances across cell membranes, thereby transporting them from regions of high concentration to regions of low concentration. Passive transport can be divided into 1-osmosis (i.e., movement of solvents), 2-diffusion (i.e., movement of solutes), and 3-facilitated diffusion (i.e., movement of molecules with help of protein channels or carriers), and 4-filtration (i.e., movement of water by using a pressure gradient).

Answer: moves particles from on area of low concentration to an area of high concentration

Explanation: Active transport differs from passive transport because active transport

can only move particles into the cell.

does not require energy to transport particles.

moves particles from an area of low concentration to an area of high concentration.

depends on the random movements of particles to carry them across the membrane.

EDG2023

Answer:

True

Explanation:

Because for each death someone is born

It's like 1+1+1-1-1=1

The answer is the same

Answer:

Explanation:

d

C. Secondary Succession

The process of an ecosystem returning to its stable form after a disaster is known as secondary succession.

This happens faster than primary succession because the soil is already formed and nutrients are more available at the beginning of the process.

Hope it helps you! ＼(^ᴥ^)／

Secondary is the type of succession that occurs when all of the usable soil has been destroyed in an ecosystem.

Succession is the process of change and development that occurs in an ecosystem over time. It refers to the gradual replacement of one community of plants and animals with another, as each community modifies the physical and biological environment in which it lives. There are two main types of succession: primary succession and secondary succession.

Primary succession occurs in an ecosystem that has no soil or vegetation, such as on newly formed volcanic islands or in areas where glaciers have retreated. During primary succession, the ecosystem must develop from scratch, with the creation of new soil and the establishment of new plant and animal communities. This process can take a significant amount of time.

Secondary succession occurs when all of the usable soil has been destroyed in an ecosystem. This type of succession can occur after a natural disaster, such as a fire or a flood, or after human activity, such as logging or farming. During secondary succession, the ecosystem must rebuild itself from scratch, with new soil being created and new plant and animal communities establishing themselves. This process can also take a significant amount of time, depending on the severity of the disturbance and the conditions of the ecosystem.

Learn more about succession, here:

https://brainly.com/question/26675203

#SPJ2

Answer: it lets for room for more buildings to be built

Explanation:

Answer:

Explanation:

1.During glycolysis,four molecules of ATP are formed,and two are expended to cause the initial phosphorylation of glucose to get the process going.This gives a net gain of two molecules of ATP

For every glucose molecule that undergoes cellular respiration, the citric acid cycle is carried out twice; this is because glycolysis (the first stage of aerobic respiration) produces two pyruvate molecules per glucose molecule. During pyruvate oxidation (the second stage of aerobic respiration), each pyruvate molecule is converted into one molecule of acetyl-CoA—the input into the citric acid cycle. Therefore, for every glucose molecule, two acetyl-CoA molecules are produced. Each of the two acetyl-CoA molecules goes once through the citric acid cycle.

The citric acid cycle begins with the fusion of acetyl-CoA and oxaloacetate to form citric acid. For each acetyl-CoA molecule, the products of the citric acid cycle are two carbon dioxide molecules, three NADH molecules, one FADH2 molecule, and one GTP/ATP molecule. Therefore, for every glucose molecule (which generates two acetyl-CoA molecules), the citric acid cycle yields four carbon dioxide molecules, six NADH molecules, two FADH2 molecules, and two GTP/ATP molecules. The citric acid cycle also regenerates oxaloacetate, the molecule that starts the cycle.

While the ATP yield of the citric acid cycle is modest, the generation of coenzymes NADH and FADH2 is critical for ATP production in the final stage of cellular respiration, oxidative phosphorylation. These coenzymes act as electron carriers and donate their electrons to the electron transport chain, ultimately driving the production of most of the ATP produced by cellular respiration.

Answer:

In the seed is the energy required for a seedling to push up out of the ground comes from food stored in the seed.

Answer:

Los autosomas o cromosomas autosómicos han sido ordenados de acuerdo a la morfología que poseen. ... Cada par de cromosomas son homólogos, es decir, contienen genes idénticos, con la misma ubicación a lo largo de cada cromosoma (locus). Ambos codifican para las mismas características genéticas.

Un autosoma es cualquier de los cromosomas, excepto los cromosomas sexuales. Los humanos tienen 22 pares de autosomas y un par de cromosomas sexuales (el par número 23, formado en las mujeres por dos cromosomas X y, en los hombres, un cromosoma X y un cromosoma Y).

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

Answer:

way of seeling and product that he/ she is seeling

Answer:

Hi, there your answer is D.Crossing Over

Hope This Helps

PLZ CORRECT ME IF I AM WRONG :)

Explanation:

Answer:

The products of mitosis are two diploid cells, whereas the products of meiosis are four haploid cells. -Mitosis and meiosis both begin with duplicated chromosomes. -In mitosis the daughter cells are genetically identical, but in meiosis the daughter cells are genetically varied.

Explanation:

Answer:

The chemical compounds that break down the insects are most likely BIOLOGICAL CATALYSTS. Venus Flytrap is a kind of carnivorous plant.9

hope it helps

Answer:

1) erodes

2)deposits

Explanation:

Answer:

the answer is C. Marine protection, research and sanctuaries Act.

Answer:

Due to presence on opposite side of the globe.

Explanation:

My model support the claim that  the Northern and Southern Hemispheres  have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.

Answer:

D. Weight varies with location, but mass does not vary

Explanation:

Weight can be defined as the force acting on a body or an object as a result of gravity.

Mathematically, the weight of an object is given by the formula;

[tex] Weight = mg [/tex]

Where;

Mass can be defined as a measure of the amount of matter an object or a body comprises of. The standard unit of measurement of the mass of an object or a body is kilograms.

Irrespective of the location of an object or a body at a given moment in time, the mass (amount of matter that they're made up of) is constant. This ultimately implies that, whether you're in the moon, space, earth or any other place, your mass remains the same (constant).

Hence, the statement that correctly compares mass and weight is that, weight varies with location, but mass does not vary. This is simply because acceleration due to gravity changes with location i.e its value varies with the planets.

Answer:

Fight initiation distance (FID) is the distance at which an animal will start to move away from an approaching threat such as a trail user.

hope this helps<3

Answer:

Our solar system and everything in it was created at roughly the same time.

Explanation:

The Big Bang theory

The Moon is about 4.51 billion years old – significantly older than previously thought. Previous studies had suggested that it formed about 150 million years after the solar system.

Eventually, erosion can break a crater down to virtually nothing. The Moon has almost no erosion because it has no atmosphere. That means it has no wind, it has no weather, and it certainly has no plants. Almost nothing can remove marks on its surface once they are made.

The Earth formed over 4.6 billion years ago out of a mixture of dust and gas around the young sun. It grew larger thanks to countless collisions between dust particles, asteroids, and other growing planets, including one last giant impact that threw enough rock, gas, and dust into space to form the moon.

Learn more about solar system here

https://brainly.com/question/1286910

#SPJ2