i need songs about lakes,trees or America

Answers

Answer 1

Answer:

Amaricana, by Halsey.

Seven Nation Army, by The White Stripes.

The Hanging Tree, by James Newton Howard.

Apple blossom, The White Stripes.


Related Questions

Celtic work songs survive despite the loss of the Irish population due to the Great Famine of 1845.

True
False

Answers

Answer:

true

Explanation:

True
Hope that helps

1. Describe the works of Georgia O'Keeffe. What are some common themes and/or forms
in her work?

Answers

Answer:

Nature and flowers

Explanation:

She worked in series, synthesizing abstraction and realism to produce works that emphasized the primary forms of nature. While some of these works are highly detailed, in others, she stripped away what she considered the inessential to focus on shape and color.

All stories must have words.
A. True
B. False

Answers

Answer:

false

Explanation:

not all stories need words

Answer and Explanation:

Fales.

Everyone has a story but you don't need words to tell a/there/your story..

1. Describe the works of Georgia O'Keeffe. What are some common themes and/or forms
in her work?

Answers

Answer:

Georgia O'keeffe (Sun Prairie,  1887 - Santa Fe, 1986) was an american artist, most known for her floral paintings.

Explanation:

Her common themes are flowers and nature. Many times her work was interpreted to have a sexual connotation, since the flowers she painted were similiar to women genitals, but she has denied this in several ocations. Her husband  Alfred Stieglitz was and art dealer and photographer, who took explicit and sensual photos of her which were thought to be the inspiration for her works as well. She also painted New York skyscrapers, and New Mexico landscapes.

Irish genres. How are they similar, and how are they different?

Answers

irish genes are different because it’s a different type of english but it’s still english i guess you can consider it “ old english”
they’re considered old english!!

Can anyone tell me the notes of the G clef.

Answers

For example, a treble clef symbol tells you that the second line from the bottom (the line that the symbol curls around) is "G". On any staff, the notes are always arranged so that the next letter is always on the next higher line or space. The last note letter, G,

define biotic factories and give three examples
please answer please please please please please please please please please, please please please please please please please please please please please

Answers

Answer:

Biotic factors are living or once-living organisms in the ecosystem. These are obtained from the biosphere and are capable of reproduction. Examples of biotic factors are animals, birds, plants, fungi, and other similar organisms.

Answer:

This is your answer. If I'm right so,

Please mark me as brainliest. thanks!!!

Question about music

Answers

TENOR is between c3 and c4

Between c3 and c4

Hope that helps

Which three famous renaissance artists did pope Julius ll commission to design art for church an himself

Answers

Answer:

Pope Julius II commissioned three famous Renaissance artists to design art for the Church and himself.

Explanation:

These artists were Michelangelo, Rafello Sanzio, and Donato Bramante. Michelangelo was hired to paint the ceiling of the Sistine Chapel.

✨Juuzou Suzuya supremacy✨

Answers

Nice picture-
of your juuzo suzuya-

Answer:

✨Juuzou Suzuya supremacía✨

Explanation:

Does anyone know this !!! If so answer ASAP

Answers

Answer:

a,g,d,f#

Explanation:

Mary and John are choosing fish for dinner for their children. What shoul
O A. fresh wild haddock fillets
B.
frozen swordfish steaks
. C.
frozen farm-raised haddock steaks
O D. farm raised haddock fillets
O E.
fresh wild haddock steaks

Answers

Answer: fresh wild haddock fillets

Any ideas for photos that show the pandemic situation?

Answers

Answer:

Do something with masks that's horror-ish

Here s an idea . Hope it helps

What is the informal name of the photograph above? a. Mother of the Depression b. Worried Mother c. The Mother d. Migrant Mother

Answers

Answer:

The answer is D. Migrant Mother

Explanation:

(plz give brainliest)

Migrant Mother is the informal name of the photograph above. Because of its sensitive subject matter, the Migrant Mother image sparked a lot of debate. The mother's plight on the agricultural field is depicted in this artwork.

What are informal names?

Informal names are the short names given by family or friends, the purpose of giving names is to find convenient calling the person rather than their formal names.

It also called  diminutive or short names of the things or person.

Thus, option D is correct.

For more information about Informal names, click here:

https://brainly.com/question/8550604

#SPJ2

Select the correct answer.

Alex is trying to decide which samples of his work to include in his graphic design portfolio. What criteria should Alex use to select samples?

A. beauty

B. variety

C. novelty

D. sincerity​

Answers

B. Variety
You have to have a little bit of everything in the graphic design portfolio.

Child with Toy Hand Grenade in Central Park, N Y C. A little boy stands in the park with the left strap of his overalls off his shoulder. He holds a toy grenade in his right hand and his left hand is clenched like a claw. What is disturbing about the boy in the above photograph?

Answers

Answer:

He is holding toy hand grenades.

Explanation:

The toy hand grenade in his hands is disturbing about the boy in the above photograph.

Why kids should not be given toy guns to play?

Playing with toy firearms is not something that kids should do. Giving your  child a fake gun could have the unintended consequence of making those who are anti-gun think they are playing with a real firearm and calling the police.

Playing with fake weapons rose when some youngsters previously displayed more hostility or when they reciprocated by increasing their actual attacks. A youngster has no concept of what is bad or good. He views using a pistol as a heroic effort to help the poor. Therefore, it is imperative to avoid playing with toy firearms. According to an old proverb, "the more you suppress something, the more it will flourish."

Learn more about disadvantages of toy guns here:

https://brainly.com/question/13610325

#SPJ3

how many members are in NCT​

Answers

Answer:

23

Explanation:

i am a big fan of NCT

Answer:

23!

Explanation:

taeil, johnny, taeyong, yuta, kun, doyoung, ten, jaehyun, winwin, jungwoo, lucas, mark, xiaojun, hendery, renjun, jeno, haechan, jaemin, yangyang, shotaro, sungchan, chenle and jisung:)

Can someone please help

Answers

Answer:

plots were based on mythological or historical figures

Explanation:

hope it help ! good luck

Describe how biodiversity contributes to the sustainability of an ecosystem.

Answers

Answer:

Biodiversity keeps the world interesting. There is a greater variety of genes and species in that ecosystem. Great variety of genes and species means the ecosystem is better able to carry out natural processes in the face of external stress. Thus, the ecosystem is more sustainable.

Explanation:

The higher biodiversity in an ecosystem means that there is a greater variety of genes and species in that ecosystem. A great variety of genes and species means that the ecosystem is better able to carry out natural processes in the face of external stress. Thus, the ecosystem is more sustainable.

Why is it important to follow through when swinging the bat?

Answers

Answer:

so you hit the baseball

Explanation:

What are the two primary factors that determine what terrestrial (land-based) biome exists in a given location?

Answers

Temperature and Precipitation

Give 4 examples of containers (of different materials) that can be used for floral arrangements:

Answers

Vase (most common)
Buckets
Tin cans
Mason jars
Tea pot
Pitchers

Which one of these composers is NOT known for his writing of film scores?
A. John Cage
B. Alan Menken
C. John Williams
D. Danny Elfman

Answers

Answer:

John Cage

Explanation:

Answer:

A

i just learned this lol

Which direction should you turn the palm of your hand? Drumsticks

Answers

Answer:

right

Explanation:

Have a nice day!

I think (RIGHT) TOOoO

Drag the tiles to the correct boxes to complete the pairs.
Match each white balance setting with its definition.
Flulescent
Tungsten
Automatic
Daylight
has a sun icon and works for full daylight
has an "A" symbol, determines the best white
shade setting, but doesn't always give the
right colors in mixed-lighting settings
Automatic
has a light bulb icon and adds warm tones
to normal daylight pictures
Daylight
has a strip light icon and compensates for
the greenish-blue color that these lights reflect
Edmentum. All rights reserved.

Answers

Daylight-  uses full daylight and has a sun icon

Automatic- has an "A" sign, select the optimal white shade option, but occasionally fails to provide the appropriate colors in mixed lighting situations.

Tungsten - adds warm tones to images taken in regular daylight and features a light bulb icon.

fluorescent-  adjusts for the greenish-blue color that these lights reflect with a strip light icon.

What does a fluorescent light do?

Fluorescence has a wide range of applications in science and technology, including mineralogy, gemology, medicine, chemical sensors (fluorescence spectroscopy), fluorescent tagging, dyes, biological detectors, cosmic-ray detection, vacuum fluorescent displays, and cathode ray tubes.

Fluorescent or black light paints frequently use the colors yellow, green, orange, and red. Fluorescence is used to enhance a wide range of research projects, from locating precious mineral resources like oil and gems to using fluorescence microscopy to study genes and cell structure.

For more information about fluorescent refer to the link:

https://brainly.com/question/24228588

#SPJ2

This is just for fun,
John's mother has 5 children. Their names are March, April, May, June, and _______?
A. July
B. August
C. May
D. John

Answers

Answer:

July?

Explanation:

:))))))))))))))))))

Answer:

The answer is D. John.

Explanation:

Lol

Please help this is for my film production class!!!!!!

Answers

It is known as typage.

Typage- the casting of actors based on the physical or personal similarity to a character

C. Typage

Hope this helps, good luck mate! :)

A painting by Sir Joshua Reynolds. A woman holds a coin over a burner with three naked figures. A woman pours a liquid from a jug into a saucer behind her. Who painted the image above?

Answers

Answer:

Lady Sarah Bunbury

Explanation:

I think I'm right. Please give brainliest to someone else! :D

There are different kinds of painting. Sir Joshua Reynolds made a painting of Lady Sarah Bunbury.

What was the Lady Bunbury Sacrificing to the Graces about?

Sir Joshua Reynolds was said to be a famous British painter of the 18th century. He was said to have founder of the British Royal Academy of Arts.

Reynolds works and supported the revival of Classical and Renaissance themes and ideals in art.

He used portraiture and history painting. He was said to have incorporated Classical mythology into his portrayal of Lady Sarah Bunbury.

learn more about Sir Joshua Reynolds from

https://brainly.com/question/8042401

What is Jim Bassler known for?

Answers

Explanation:

Using natural fibers, he creates weavings that he dyes using resist methods and often cuts the weavings apart and sews them into something new.

What is wrong with the proportions of these figures?

Write a complete sentence to explain what is out of proportion.

Answers

Answer:

They got some long arms and legs

Explanation:

1. Their feet look as though they’re about to break off their bodies. 2. They do have long legs compared to the rest of their body. 3. The head is way too small and if they are supposed to resemble humans, they’d have more dimension and more human like skull structures.
Other Questions
In his free time, Gary spends 11 hours per week on the Internet and 8 hours per week playing video games. If Gary has five hours of free time per day, approximately what percent of his free time is spent on the Internet and playing video games? n the railroad accident, a boxcar weighting 200 kN and traveling at 3 m/s on horizontal track slams into a stationary caboose weighting 400 kN. The collision connects the caboose to the car, and then both move together and you have found the final velocity. Apparently, initial kinetic energy of the system changes (in part, because of friction present). How much energy (in kJ) is transferred from kinetic energy to other forms of energy (e..g., thermal) in the collision In a family with parents who do not have hemophilia, one son has hemophilia. Who was the carrier of the gene for hemophilia?*if possible, I also need a Punnett square * __C+_SO2_CS2 + __CO Which ecosystem would be affected the most by losing its butterflies, and why? A. Ecosystem 2 because it has more kinds of plants, animals, and insects. B. Ecosystem 1 because it has more plants that depend on the butterfly. C. Ecosystem 2 because it has more insects that compete with the butterfly. D. Ecosystem 1 because it has fewer kinds of plants, animals, and insects. How could the differences in geography and economic activities create tensions between the regions of the United States listed? Explain 15% of 20 is ??? please helpp What is the distance between (3,7) and (-3,-1) ? 1) How many organs of central government are there? Name them A uniform electric field exists in a region between two oppositely charged plates. An electron is released from rest at the surface of the negatively charged plate and strikes the surface of the opposite plate, 2.0 cm away, in a time 1.5 x 10-8 s. The speed of the electron in millions m/sec as it strikes the second plate is: A. 13.3 B. 133 C. 2.67 D. 26.7 E. 534 In the late1890s, who created a support system to help African American businesses? Jim Crow Pat McCrory W.C. Coleman A.M. Waddell Please Help ASAP before midnight. Write a unit rate for the situation.$12.50 for 5 ouncesAlso if you can, with your answer can you tell me how to find unit rate? A pyramid with an equilateral-triangle base has a volume of 48sqrt{3} cm3 and a height of 16 cm. Find the length of each side of the equilateral triangle.You get brainliest, i need answers fast. How was religion in ancient Rome similar to religion in ancient Greece? (Choose 3)ARoman gods had the same names.BRoman gods had human-like qualities.CRoman religion was polytheistic.DRoman gods were different aspects of one God.ERoman religion included a holiday called Saturnalia.FRoman gods played an important role in everyday life by protecting families, homes, farms and even animals. Rewrite the number in Standard form6 x 10^8 What is the main source of winds and weather? A. The spinning EarthB. The Earth's rotation on its axisC. The layers of the planetD. The sunI will mark correct answer brainliest 3+4-8+9-8+78+99-7999+8799+06997+90797883+677_5= May someone help me with this :) Describing Work ActivitiesNote that common tasks are listed toward the top and less common tasks are listed toward the bottom.According to O*NET, a pharmacy technician should be able to use computers to enter, access or retrieve data to adhere to safety procedures and use the metric system.What Work Activities are being described? Check all that apply.a. processing informationb. getting informationc. interacting with computersd. evaluating information to determine compliance with standardse. identifying objects, actions and eventsf. updating and using relevant knowledge 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA