If the area of a circle is 25pi (n), what is the radius of the circle

Answers

Answer 1

Answer:

5

Step-by-step explanation:

the are is pi times radius times radius

so do the square root of 25, which is 5.

this means that the radius is 5

Answer 2

Answer:

five (5).

Step-by-step explanation:

Area of circle =pi r^2

given that area is 25pi

now equate both .....we get

25pi=pi r^2

25=r^2

r=5


Related Questions

8. Over a period of 3 hours, the outside temperature changed an average of -2.25 Fahrenheit per hour. Which statement correctly describes the change in the temperature from the beginning to the end of the 3 hour period?


a. The temperature decreased by 0.75 degrees Fahrenheit.

a. The temperature decreased by 0.75 degrees Fahrenheit.


b. The temperature increased by 0.75 degrees Fahrenheit.

b. The temperature increased by 0.75 degrees Fahrenheit.


c. The temperature decreased by 6.75 degrees Fahrenheit.

c. The temperature decreased by 6.75 degrees Fahrenheit.


d. The temperature increased by 6.75 degrees Fahrenheit.

Answers

Answer:

c

Step-by-step explanation:

-2.25*3 = 6.75 decreased (since negative)

Given f(x) = -2 and g(x) = 5x - 6, find h(x) = f(x) ⋅ g(x)

h(x) = _____ x _____ _____

Answers

Answer:

10x+12 is the answer in my calculation.

help pls

Find the solution of this system of equations
8x - 5y = -25
-2x - 5y = -25
Enter the correct answer.

Answers

Answer:

x=0 and y=5

Step-by-step explanation:

8x-25+2x=-25

Somebody help plz I need help

Answers

In this case, we need to substitute n with 10.

So, it is like this: f(10) = 3(10) + 4

f(10) = 3(10) + 4

f(10) = 30 + 4

f(10) = 34

Rewrite the equation 6x – 9y = 12 in terms of y.

Answers

Answer:

Step-by-step explanation:

6x - 9y = 12

subtract 6x from both sides

-9y = 12 - 6x

divide both sides by -9

y = -4/3 + 2/3x

or

y = 2/3x - 4/3

The equation 6x – 9y = 12 written in terms of y is; y = (2/3)x - 4/3

We are required to write the equation 6x – 9y = 12 in terms of y.

Rewriting the equation 6x – 9y = 12 in terms of y is as follows;

6x – 9y = 12

6x - 12 = 9y

Divide through by 9 so that we have;

y = (2/3)x - 4/3

Read More on Change of formula subject:

https://brainly.com/question/9584546

By rounding each of 9.85, 3.875 and 6.3 to the nearest whole number work out an estimate for the answer to 9.85^3 / 3.875 + 6.3^2

Answers

Answer:

286.

Step-by-step explanation:

9.85^3 /3.875 + 6.3^2

= 10^3/ 4 + 6^2

= 1000/4 + 36

=250 + 36

=286.

Okie help plzzzzz I need it

Answers

Answer:

the answer is 4.5 but you cannot plant 4 and a half seeds. so the answer would be 3.

Step-by-step explanation:

Answer:

3x + 9

Step-by-step explanation:

You basically want the total amount of seeds so if he plants x in one garden and 2x + 9 in another, you add them both

x + 2x + 9

Equals 3x + 9

Find two consecutive even integers such that the sum of the smaller and 3 times the larger is 330
I am so stuck please any one help

Answers

Answer:

The 2 numbers = 81 and 83

Step-by-step explanation:

As, one number = x

The other, because it's an even number and consecutive = x + 2

So the larger numbef here is x + 2

And they are saying 3 times x + 2 plus x = 330

So let's solve!

3 times x + 2 = 3(x+2) = 3x + 6

So we will add it to x = (3x + 6) +(x) = 4x + 6

So they are saying the sum of them will be 330

So, 4x + 6 = 330

4x = 330 - 6

4x = 324

x = 324/4

x = 81

So x is the first number = 81

And the second is x + 2 = 81 + 2 = 83

So the 2 numbers are 81, 83

Lets check!

3 times the bigger number = 83 x 3 = 249

We will add it to 81 and we will get 330

So, 249 + 81 = 330

So the answer is right

ago
7
.
15
6
7
10. Which of the following could be the
perimeters of the three squares below?
A. 12 ft, 16 ft and 20 ft
B. 20 ft, 16 ft and 24 ft
C. 40 ft, 80 ft and 120 ft
D. 16 f1, 24 ft and 28 ft
Maneuvering the Middle LLC, 2017

Answers

Answer:

where are the squares?

Step-by-step explanation:

Melanie works at a frozen yogurt stand after school. The stand sells fruit and yogurt smoothies for $3.00 each and soft-serve cones for $2.00 each. On a hot summer day, the stand sold 12 more smoothies than soft-serve cones for total sales of $206. Which of the following systems of equations could be used to find s
s
, the number of smoothies, and c
c
, the number of cones the shop sold that day?

Answers

Answer:

3s+2c=206

s=c+12

Step-by-step explanation:

3.00(smothies,s) + 2.00(cones,c) = $206 (total)

s,smoothies = c,cones + 12

Look at the pictures and solve. WILL GIVE BRAINIEST
Drag the tiles to the correct boxes to complete the pairs. Not all tiles will be used.
Match each graph to the equation of its line.

Answers

Answer:

1. y = 4x - 4

2. y = x + 2

3. y = -2x - 4

4. y = -x + 2

Step-by-step explanation:

Slope-intercept form is y = mx+b. As we know, m is the slope and b is the y-intercept. We need to find the slope and y-intercept and put them in the equation. Slope is rise over run, so we just count up then over until we get to an intersection. For the y-intercept, we look where the line crosses the y-axis.

50 points !!!!!!!!!!!!!! answer the question please help
I will give bairnleast

Answers

[tex]\boxed{\large{\bold{\textbf{\textsf{{\color{blue}{Answer}}}}}}:)}[/tex]

Shape and pattern are the element of art and principal of designdid the artist manipulated to create texture on this scripture.

Answer:

Shape and pattern {final answer}

Step-by-step explanation:

The element of art and principal of design did the artist manipulate to create texture on this sculpture is shape and pattern. This option best suits for most of the sculptures. Therefore, the last option is the required answer.

first to answer right gits brianlies
To evaluate a variable expression, you must__values for the variable, and then calculate the result.

Answers

Answer:

find is the Answer

Step-by-step explanation:

Write the number seven hundred and ninety four in figures

Answers

Answer: 56 785 is written as fifty six thousand, seven hundred and eight five. The number 406 090 is written as four hundred and six thousand and ninety. Numbers with seven, eight or nine digits, are millions. 46 758 442 is forty six million, seven hundred and fifty eight thousand, four hundred and forty two.

Step-by-step explanation:

The number would be 794 in figure form which represents seven hundred and ninety-four.

What is the number system?

A number system is defined as a way to represent numbers on the number line using a set of symbols and approaches. These symbols, which are known as digits, are numbered 0 through 9. Based on the basic value of its digits, different types of number systems exist.

Calculating the number of quantities for an object or the Number of things left in the container are only two examples of the types of mathematical operations that utilize the Number System.

We have to write the number seven hundred and ninety-four in figures

As per the given statement, the expression would be:

⇒ 700 + 94

⇒ 794

Therefore, the number seven hundred and ninety-four in figure form would be 794.

Learn more about the number system here:

https://brainly.com/question/21751836

#SPJ5

Help please ill give brainliest

Answers

Answer:

Red line is y=0.8x

Blue line is y=0.8x-3.2

Step-by-step explanation:

please help........ ​

Answers

x = √(10²+24²)

= √(100+576)

=√(676)

= 26.

Answer:

26

Step-by-step explanation:

since wz is a tangent to the circle then measure angle wzy equal 90° so you will be using Pythagoras therom then X = (24)^2 + (10)^2 all under a square root as it's a hypotenuse

can u help me find the answer quickly ​

Answers

Answer:the second one

Step-by-step explanation: hope this helps

6 ft
x ft
8 ft
12 ft

Answers

Answer:

576?

Step-by-step explanation:

I think...

what the answer 68 ÷4​

Answers

Answer:

17

Step-by-step explanation:

Answer:

17 ;-; cant you use a ? calculator?

Step-by-step explanation:

help please this has to be done ​

Answers

Answer:

100

Step-by-step explanation:

a triangle is 180, so 180-58-22 is your answer

im confused right now.

Answers

Answer:

x = -45

Step-by-step explanation:

In a standard 52-card deck, half of the cards are red and half are black. The 52 cards are divided evenly into 4 suits: spades, hearts, diamonds, and clubs. Each suit has three face cards (jack, queen, king), and an ace. Each suit also has 9 cards numbered from 2 to 10. 7.

Dawn draws 1 card, replaces it, and draws another card. Is it more likely that she draws 2 red cards or 2 face cards?​

Answers

Answer:

It is more likely she draws 2 red cards

Step-by-step explanation:

Given that:

Number of red d cards in deck = 26

Number of face cards = 4 * 3 = 12 face cards

If two cards are drawn with replacement ;

Probability = (required outcome / Total possible outcomes)

P(1st card red) = 26 /52) = 1/2

P(2nd card red) = 26 /52 = 1/2

P(1st card red) * P(2nd card red)

1/2 * 1/2 = 1/4 = 0.25

P(1st card face card) = 12/52 = 3/13

P(2nd card, face card) = 12/52 = 3/13

P(1st card face card) * P(2nd card face card)

3/13 * 3 /13 = 9/169 = 0.053

0.25 > 0.053

It is more likely she draws 2 red cards

Зу – х = -5
-7х + 4 = –18
Solve each system of equation using elimination

Answers

Answer:

(1)xy=-5-3

-8ans

Step-by-step explanation:

(2) -3x =-18

-15ans

What’s the solution for x- 5 =5

Answers

Answer:

x=10

Step-by-step explanation:

10-5=5

Answer:

x= 10

Step-by-step explanation:

x-5 =5

x= 5+5

x= 10

zz

Can someone help me please

Answers

Answer: A) m = 9, n = 9

==========================================================

Explanation:

This is a 45-45-90 right triangle. Any triangle of this form is isosceles, where the two legs are the same length. In this case, m and n are those two legs. So m = n.

We can then apply the Pythagorean theorem to say

a^2 + b^2 = c^2

m^2 + n^2 = (9*sqrt(2))^2

m^2 + m^2 = 9^2*(sqrt(2))^2

2m^2 = 81*2

m^2 = (81*2)/2

m^2 = 81

m = sqrt(81)

m = 9

As a shortcut, the hypotenuse of a 45-45-90 triangle is equal to sqrt(2) times the length of either leg. If m is the length of the leg, then m*sqrt(2) is the length of the hypotenuse. So in a sense, we take this thought process backwards to go from a hypotenuse 9*sqrt(2) to a leg length of 9.

The manager of a symphony in a large city wants to investigate music preferences for adults and students in the city. Let pA represent the population proportion of adults who live in the city who prefer pop music. Let pS represent the population proportion of students who live in the city who prefer pop music. Random samples of 200 adults from the city and 200 students from the city will be selected. Which of the following is the best interpretation of P(pˆA−pˆS>0)≈0.022 ?

Answers

Answer:

Answer E

Step-by-step explanation

The statement gives a probability of approximately 0.022 for the difference in sample proportions, pˆA−pˆS, being greater than 0.

The interpretation of the given expression is "the difference between the population proportion of adults and the population proportion of students who prefer pop music is approximately 0.022".

Given :

pA is the population proportion of adults.pS is the population proportion of students.The total number of adults is 200 and the total number of students is also 200.

The following steps can be used in order to determine the best interpretation of the given expression:

Step 1 - According to the given data, pA is the population proportion of adults who live in the city who prefer pop music.

Step 2 - Also given that pS is the population proportion of students who live in the city who prefer pop music.

Step 3 - So, the interpretation of the given expression is "the difference between the population proportion of adults and the population proportion of students who prefer pop music is approximately 0.022".

Therefore, the correct option is A).

For more information, refer to the link given below:

https://brainly.com/question/8069952

-7 2/3+ (-5 1/2) + 8 3/4
=

Answers

Answer:

-4 5/12

Step-by-step explanation:

Answer:

Step-by-step explanation:

-4.41666666667

PLEASE HELP! it’s would be really appreciated

Answers

Answer:

46 degrees

Step-by-step explanation:

180 - 102 - 32 equals to 46

1. 2x + 5 = 9
2. 9 + 3x = 18
3. 2x - 16 54
4. 2(x + 1) = 8
5. 4m-316
(pls help me to answer this)​

Answers

Answer:

1. 2

2. 3

3. 35

4. 3

5. m=79

1. 2(2) + 5 = 9
2. 9 + 3(3) = 18
3. 2(35) - 16= 54
4. 2(3+ 1) = 8
5. Actually, number 5 doesn’t provide an answer to solve for.

Glad I could help and also, can you please mark my answer as the brainliest answer?
Thank you so much!

Which of the following is the best estimate for the weight of a pick-up truck?
5 T
5 gal
5 lb
5 mi

Answers

Answer:

5 T

Step-by-step explanation:

It is the only one remotely close to the weight of a pick-up truck.

the weight of a pickup truck is usally 5000-7000 pounds
Other Questions
The Venn diagram below shows some of the services provided by national and state governments.Which service completes the Venn diagram? (3 points)A. Raise and collect taxesB. Declare war and make peaceC. Make marriage lawsD, Coin and print money Solve: 68 x = 14 ( please i really need these super fast thank you! ) happy new year. eeeeeeeee e I need help ASAP please Which sentence is best structured to present two ideas of equal importance?A. Since NASA was founded, it has sent more than 250 astronautsinto space.B. The mission of NASA is to explore outer space.C. Some people think that NASA should focus on exploring theuniverse, but others believe that building a colony on the moon isthe most important goal, even though it will be difficult.D. NASA is known for sending humans to the moon, but the famousspace program has also sent an unmanned spaceship to Mars. DETERMINE THE MISSING SIDE Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What caused the original creation of the Universe? How do we find out? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia List two equivalent numbers to 0.50 Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make? You know I never approved of it, pursued Utterson, ruthlessly disregarding the fresh topic.My will? Yes, certainly, I know that, said the doctor, a trifle sharply. You have told me so.Well, I tell you so again, continued the lawyer. I have been learning something of young Hyde.The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. I do not care to hear more, said he. This is a matter I thought we had agreed to drop.The Strange Case of Dr. Jekyll and Mr. Hyde,Robert Louis StevensonWhere in the plot is this passage found?the expositionthe rising actionthe falling actionthe resolution How do blood types react in a transfusin ? plz help me with this What current passes through a 1 kW heater with 25 V across it? 1) Choose the correct answer. I NEED HELP ASAPThe destination of many Roman Catholic pilgrimages was ______.the Holy Landthe Holy Roman EmpireAfricaKievRome