Solve for x: 5x + 2 = 4x - 9

Answers

Answer 1

Answer:

x = - 11

Step-by-step explanation:

Given

5x + 2 = 4x - 9 ( subtract 4x from both sides )

x + 2 = - 9 ( subtract 2 from both sides )

x = - 11

Answer 2

Answer: x = -11

Step-by-step explanation:

Move all terms containing  x  to the left side of the equation.

A mathematical statement that says two expressions have the same value; any number sentence with an  = .


Related Questions

The Bookstall Inc. is a specialty bookstore concentrating on used books sold via the Internet. Paperbacks are $1.35 each, and hardcover books are $3.50. Of the 60 books sold last Tuesday morning, 55 were paperback and the rest were hardcover. What was the weighted mean price of a book? (Round your answer to 2 decimal places.)

Answers

Answer:

dddddd okaksy ogvurn

Step-by-step explanation:

d

bananas cost $4 and apples close 0.60$ each if b represents the number of bunches of bananas and a represents the number of apple which of the following expressions represents the total cost? 1 4.60(b+a) 2 4b + 0.60 3 4.60 + a 4 4.60ab

Answers

Answer:

4b + .60a

Step-by-step explanation:

b represents the number of bunches of bananas

a represents the number of apple

Multiply the cost by the number purchased of each item and add them together

4b + .60a

Answer:

[tex]\huge\boxed{\$ (4 b + 0.60 a)}[/tex]

Step-by-step explanation:

Bananas represented by b

1 banana costs $4 so b bananas will cost $ 4 b

Apples represented  by a

1 apples costs 0.60 $ so a apples will cost $ 0.60 a

Totally, they will cost:

=> $ (4 b + 0.60 a)

PLEASE HELP ME!!! The students in Suzanne's school are painting a rectangular mural outside the building that will be 15 feet by 45 feet. To prepare they are create a scale drawing that represents 20% of the given dimensions. What is the length and width of the scale drawing?

Answers

Answer:

length of scale drawing = 9 feet

width of scale drawing = 3 feet

Step-by-step explanation:

Actual dimension  15 feet by 45 feet.

length = 45 feet

width = 15 feet

Dimension on drawing is 20% of actual dimension.

20% = 20/100

Thus,

20% of 15 feet = 20/100 * 15 feet = 3 feet

20% of 45 feet = 20/100 * 45 feet = 9 feet

Thus, length of scale drawing = 9 feet

width of scale drawing = 3 feet

In rectangle ABCD, point E lies half way between sides AB and CD and halfway between sides AD and BC. If AB=10 and BC=2, what is the area of the shaded region? Answer as a decimal, if necessary. Little confused on this one.

Answers

Answer:

10 units²

Step-by-step explanation:

Consider the unshaded region to consists of 2 triangles, ∆AED and ∆BEC, which are both of equal dimensions. Their bases and heights are both the same. Both triangles are embedded inside a rectangle ABCD.

Area of the shaded region = Area of rectangle - area of the 2 triangles.

Area of rectangle = l*w

l = 10

w = 2

[tex] Area_R = 10*2 = 20 units^2 [/tex]

Area of the 2 triangles = 2(½*b*h)

b = 2

h = 5

[tex]Area_T = 2(\frac{1}{2}*2*5)[/tex]

[tex] Area_T = 1*2*5 = 10 units^2 [/tex]

Area of shaded region = 20 - 10 = 10 units²

A museum curator is hanging 7 paintings in a row for an exhibit. There are 4 Renaissance paintings and 3 Baroque paintings. From left to right, all of the Renaissance paintings will be hung first, followed by all of the Baroque paintings. How many ways are there to hang the paintings

Answers

Answer:

144 ways

Step-by-step explanation:

Number of paintings = 7

Renaissance = 4

Baroque = 3

We are hanging from left to right and we will first hang Renaissance painting before baroque painting.

For Renaissance we have 4! Ways of doing so. 4 x3x2x1 = 24

For baroque we have 3! Ways of doing so. 3x2x1 = 6

We have 4!ways x 3!ways

= (4x3x2x1) * (3x2x1) ways

= 144 ways

Therefore we have 144 ways to hang the painting.

On the maturity date of a $10,800, 6-month, 8% note, the borrower sends a check that includes the principal and all of the interest due on the note. What is the amount of the borrower's check?​

Answers

Answer: $ 11,232.00

Step-by-step explanation:

Given:  Amount = $ 10,800

Interest Rate = 8%   =0.08

Time in Months= 6.00

Formula :

Interest on Note = (Amount)× (Interest Rate) × ((Time in Months) /12)

= (10800)× (0.08)× (6/12)

= $432

The amount of the borrower's check =(Amount + Interest on Note)

= $ (10,800+432)

= $ 11,232.00

Hence, The amount of the borrower's check = $ 11,232.00

point a is at (6,-6) and point c is at (-6, -2)
Find the cooridantes of point b on AC such that AB=3/4 AC

Answers

Answer:

(-3,-3)

B=(6-9,6+3)

in the diagram, find the values of a and b.​

Answers

Answer:

           m∠a = 67° ,   m∠b = 42°

Step-by-step explanation:

∠a is alternate interior angle to ∠ECD

∠b is alternate interior angle to ∠BCD

so:

If AB || CD then:

m∠a = m∠ECD = 25° + 42° = 67°

m∠b = 42°

domain and range A) D: (–7, –2], (–1, 3] R: (–10, 9.2] B) D: [–7, –2], [–1, 3] R: [–10, 9.2] C) D: (–7, 3] R: (–10, 9.2] D) D: (–7, –2), (–1, 3) R: (–10, 9.2)

Answers

Answer:

[tex]\Large \boxed{\mathrm{C) \ D: (-7, 3] \ R: (-10, 9.2]}}[/tex]

Step-by-step explanation:

The domain is the set of all possible x values.

The range is the set of all possible y values.

For the domain, we observe the graph, the graph will contain all the x values shown on the x-axis.

[tex]\mathrm{D= (-7,3] }[/tex]

For the range, we observe the graph, the graph will contain all the y values shown on the y-axis.

[tex]\mathrm{R= (-10,9.2] }[/tex]

A population consists of 100 elements. We want to draw a simple, random sample of 20 elements from this population. On the first selection, the probability of any particular element being selected is ____.

Answers

Answer:

1/5

Step-by-step explanation:

Probability is the likelihood or chance that an event will occur.

Probability = expected outcome of event /total outcome

Since the population consists of 100 elements, the total outcome of event = 100.

If random sample of 20 element is drawn from the population, the expected outcome = 20

On the first selection, the probability of any particular element being selected = 20/100 = 1/5

What are the zeros of the quadratic function represented by this graph?
У
A
6
2
X
-6
- 2
6
2-
-6-
A.
1 and 3
OB.
-3 and -1
C.
-3 and 1
D. -1 and 3

Answers

Answer: C.  -3 and 1

Look where the parabola crosses the x axis. This is where the x intercepts are located. The term "x intercept" is the same as "root" and also the term "zero".

A man claims to have extrasensory perception (ESP). As a test, a fair coin is flipped10 times and the man is asked to predict the outcome in advance. He gets 7 out of10 correct. What is the probability that he would have done at least this well if hehad no ESP?

Answers

Answer:

I would say 70%

Step-by-step explanation:

He got 7 of of 10 (7/10 = 70%) right so I  would say he would do just as well without ESP since it doesn't exist.

Sketch the region enclosed by the given curves. Decide whether to integrate with respect to x or y. Draw a typical approximating rectangle. y = x2 − 4x y = 3x

Answers

Answer:

Hello your question is incomplete attached is the missing part the second curve ; y = 3x is incomplete so i would solve the problem taking the second curve as ; y = 3x + 8 ( giving you the general methodology )

answer : y = ( 5,32) , x = ( -1,8 )

area of shaded region = 90.673

Step-by-step explanation:

The given curves ; [tex]y = x^2 - 4x\\y = 3x +8[/tex]

solving the above curves simultaneously

[tex]x^2-4x = 3x + 8[/tex]

x^2 - 7x - 8 = 0

( x + 1 )(x - 8 ) = 0

hence  X = ( -1 , 8 )

Therefore y = 3x + 8

when x = -1 ,  y = -3 + 8 = 5

when x = 8 ,  y = 24 + 8 = 32

hence y = ( 5, 32 )

attached below is the sketched region

Integrating the curves to determine the shaded area in respect to x = ( -1, 8)

∫ [( 3x +8 ) - ( x^2 - 4x ) ] dx

∫ ( -x^2 +7x + 8 ) dx

= { - x^3/3  + 3x^2 + 8x }

= { - 8^3/3 + 3(64) + 64} - { -1^3/3 + 3 - 8 }

= {-170.66 + 192 + 64 } - { -1/3 - 5 }

= -170.66 + 192 + 64 + 5.333 = 90.673 ( area of the shaded region )

PLEASE HELP!
Suppose there is a strong positive correlation between mand n. Which of the
following must be true?
A. An increase in m causes n to increase.
B. When m increases, n tends to decrease.
C. When m increases, n tends to increase.
D. An increase in m causes n to decrease.

Answers

Answer:

A an increase in m cause n to increase

Step-by-step explanation:

a positive correlation means they will travel in the same direction when one is affected.

Answer:

Option A: An increase in m causes n to increase.

Step-by-step explanation:

A Positive correlation is a relationship between two variables in which both variables move with the same ratio. A positive correlation exists when one variable increases as the other variable increases, or vice-versa.

A perfect positive correlation means that both variables move by the exact same percentage.

Therefore, if there is a strong positive correlation between m and n then  V increases and, w tends to increase.

     

                           Hope this helped :)

Suppose you have read two different books on world war 2 and each book has different arguments about how the war started which of the following sources provides the best support for the authors arguments

Answers

Answer:

Well this is my opinion I would try to compared both them and see if they have something familiar in their arguments. If not I would try to view their different point of view and write your own opinion about it. I would check out another book about the World War 2 because there's infinite of books about it.

What is the lateral area of the drawing is it a 200 km.b. 425.c.114d.1021km

Answers

Answer:

114 km

Step-by-step explanation:

Each side is an isosceles trapezoid, so ED=2 since you would need to add 2 to each end of the bottom line to get the top line. Now use Pythagorean Theorem to get ED^2+AD^2=AE^2. Plug in your numbers to solve for AE. This is the height of each trapezoid. Then use your formula for the area of a trapezoid, (B1+B2)h/2, to get the area of each side, then multiply by 4 to get the lateral area since there are 4 sides. Remember lateral area is just the sides, then surface area is when you include the area of the two bases.

Emile is a long-distance trucker. In one week he drives miles from his home in Fort Lauderdale, FL, to Benson, NC. He then drives miles to Barstow, CA, and continues driving miles to Bakersfield, CA. From there, Emile drives miles to Seattle, WA. Estimate the total distance Emile travels by first rounding each distance to the nearest hundred. Do not put units in your answer.

Answers

Answer:

Estimated total distance is 1,900 miles.

Step-by-step explanation:

We begin by adding each distance traveled by Emile:

1. Fort Lauderdale, FL, to Benson, NC = 748 miles

2. Barstow, CA, to Bakersfield, CA = 130 miles

3. Bakersfield, CA.  to Seattle, WA = 1030 miles

Total miles = 1,908.

Therefore, in one week Emile's total distance to the nearest hundred is 1,900.

Note: the distances where gotten via Google Map.

Find a • b. a = 5i + 7j, b = -4i + 3j (5 points)
<1, 10>
<-20, 21>
1
41

Answers

Answer:

[tex]a\cdot b[/tex] = 1

Step-by-step explanation:

Given that,

Vector [tex]a=5i+7j[/tex]

Vector [tex]b=-4i+3j[/tex]

We need to find [tex]a{\cdot} b[/tex] means the dot product of a and b. So,

[tex]a{\cdot} b=(5i+7j){\cdot} (-4i+3j)[/tex]

We know that,

[tex]i{\cdot}i, j{\cdot}j,k{\cdot}k=1\ \text{and}\ i{\cdot}j= j\cdot i=0[/tex]

So,

[tex]a{\cdot} b=(5i+7j){\cdot} (-4i+3j)\\\\=5i{\cdot}(-4i)+5i{\cdot} 3j+7j\cdot(-4i)+7j\cdot 3j\\\\=-20+21\\\\=1[/tex]

So, the value of [tex]a\cdot b[/tex] is 1.

Answer:

1

Step-by-step explanation:

What is the name of a number that can be written in the form a + bi where a and b are nonzero real
numbers? (1 point)
a pure imaginary number
an imaginary unit
a real number
a complex number

Answers

Answer:

Complex numbers

Step-by-step explanation:

Given

[tex]a + bi[/tex]

Required

Determine the type of number in that form

Numbers written in [tex]a + bi[/tex] are referred to as complex numbers

Where [tex]a \neq 0[/tex]; [tex]b\neq 0[/tex] and [tex]i = \sqrt{-1}[/tex]

Note that a and b can either integers or non integers and a and be can also be positive or negative

The following are valid examples of complex numbers

[tex]2 + 3i[/tex]

[tex]2.4 - 5i[/tex]

[tex]-3 - i[/tex]

and lots more..

State the correct polar coordinate for the graph shown:

Answers

Answer:

Solution : ( - 8, - 5π/3 )

Step-by-step explanation:

There are four cases to consider here, the first two with respect to r > 0, the second two with respect to r < 0. For r < 0 we have the coordinates ( - 8, 60° ) and ( - 8, - 300° ) . - 300° in radians is - 5π/3, and hence our solution is option d. But let me expand on how to receive the coordinates. Again r is the directed distance from the pole, and theta is the directed angle from the positive x - axis.

So when r is either negative or positive, we can tell that this point is 8 units from the pole. Therefore - r = - 8 in both our second cases ( we are skipping the first two cases for simplicity ). For r < 0 the point will lay on the ray pointing in the opposite direction of the terminal side of theta.

Our first coordinate is ( - 8, 60° ). Theta will be 2 / 3rd of 90 degrees, or 60 degrees, for - r. Respectively the remaining degrees will be negative, 360 - 60 = 300, - 300. Our second point for - r will thus be ( - 8, - 300° ) . - 300° = - 5π/3 radians, and our coordinate will be ( - 8, - 5π/3 ).

100 students are interviewed to see which of biology, chemistry or physics they prefer.
59 of the students are girls. 35 of the girls like biology best.
2 of the boys prefer physics.
6 out of the 30 who prefer chemistry are girls.
What percentage of the students prefer biology?

Answers

Answer:

50%

Step-by-step explanation:

Girls                                            Boys

total:                 59                     total:                              41

- Chemistry       35                   - Physics                           2

                       = 24                                    =                     39

                                                 - Chemistry ( 30 - 6 )      24

                                                                   =                     15

Total boys and girls for Biology = 35 + 15 = 50

% = 50/100*100

   = 50%

Hope it helps and also mark it as brainliest!!!!

1.
The ratio of the numbers of sides of two regular polygons is 1:2 .If each interior angle of the first
polygon is 1200 then the measure of each interior angle of the second polygon
is
(1)1400
(2)1350
(3)1500
(4)1600

Answers

first polygon

ext. angle=180°-120°

=60°

[tex]ext \: ang = \frac{360}{n} [/tex]

n=360°/60°

n=6

second polygon

n=2(6)=12

ext. ang= 360°/n = 360°/12° = 30°

int. ang = 180°-30°= 150°

answer is C

If the ratio of the numbers of sides of two regular polygons is 1:2 and each interior angle of first angle is 120° then the measure of each interior angle of the second polygon is 150° which is option 3).

What is regular polygon?

A regular polygon is a polygon whose all sides are equal to each other.

How to find interior angle?

We have been given ratio of sides of two polygon that is 1:2 and the interior angle of first polygon that is 120 degrees.

Exterior angle will be 180-120=60°

We know that exterior angle =360/n where n is the sides of the polygon.

60=360/n

n=360/60

n=6

Number of sides of other polygon=2*6=12

Exterior angle=360/n

=360/12

=30

Interior angle=180-30=150°

Hence the interior angle of the second polygon is 150 degrees.

Learn more about regular polygon at https://brainly.com/question/1592456

#SPJ2

Find the missing term in the
geometric sequence.
13,[ ? ],208

Answers

Answer:

110.5

Step-by-step explanation:

208=13+(3-1)d

208=13+2d

-13. -13

195=2d

÷2. ÷2

97.5=d. (d means difference)

13(first term)+97.5=110.5

Answer: 676

Step-by-step explanation: r/13=208/r

                                             r²=2704

                                               r=52

                                               13x52=676

                                               

3
Select the correct answer.
Which equation represents the line that is parallel to y= 2 and passes through (-1,-6)?
OA x=-1
OB
X= 2
OCy= -6
OD. y= 2x - 4
Reset
Next

Answers

Hey there! I'm happy to help!

Lines that are parallel have the same slopes because they are increasing or decreasing at the same rate and therefore will never bump into each other.

We see that y=2 has a slope of 0 because there is no x that we can see in the equation. This is just a flat line.

If the line we are looking for is flat; it stays at the same y-value the entire time. We see that  the y-value for this line of ours is -6. Therefore, the answer is C. y=-6.

I hope that this helps! Have a wonderful day!

Answer:

Lines that are parallel have the same slopes because they are increasing or decreasing at the same rate and therefore will never bump into each other.

We see that y=2 has a slope of 0 because there is no x that we can see in the equation. This is just a flat line.

If the line we are looking for is flat; it stays at the same y-value the entire time. We see that  the y-value for this line of ours is -6. Therefore, the answer is C. y=-6.

Step-by-step explanation:

; ) BELIEVE IN YOURSELF!!!!!!!!!!!!!!!!!

The first side of a triangle measures 3 in. less than the second side, the third side is 2 in. more than the first side, and the perimeter is 20 in. Set up an equation that relates the sides of the triangles in terms of the perimeter of the triangle.

Answers

Answer:

P = 3x - 4

Step-by-step explanation:

Side 1 = x - 3

Side 2 = x

Side 3 = 2 + (Side 1) = 2 + x - 3 = x - 1

Perimeter = 20 in

Perimeter = Side 1 + Side 2 + Side 3

Perimeter = (x - 3) + (x) + (x - 1)

Perimeter = x - 3 + x + x - 1

Perimeter = 3x - 3 - 1

Perimeter = 3x - 3 - 1

Perimeter = 3x - 4

P = 3x - 4

Let U = {1, 2, 3, 4, 5, 6, 7, 8, 9 } A= {1, 2, 3, 4} and B= {4, 5, 6, 7}. Draw the Venn diagram of A ∩B. Answer with full explanation and diagram will be marked as brainliest for sure!!!

Answers

Step-by-step explanation:

Its mean the same number for both A and B which is only 4.

15 POINTS AND BRAINLIEST JUST HELP ME PLZZZZZ 4x^2 + 28x + 49 = 0 Rewrite equation (x + __ )^2 = __

Answers

Answer:

[tex]\boxed{(x+7)^2 =-3x^2-14x}[/tex]

Step-by-step explanation:

[tex]4x^2 + 28x + 49 = 0[/tex]

[tex]\sf Subtract \ 3x^2 \ and \ 14x \ from \ both \ sides.[/tex]

[tex]4x^2 + 28x + 49 -3x^2-14x= 0-3x^2-14x[/tex]

[tex]x^2 + 14x + 49 = -3x^2-14x[/tex]

[tex]\sf Factor \ left \ side \ of \ the \ equation.[/tex]

[tex](x+7)^2 =-3x^2-14x[/tex]

Answer:

(x+7)² = -3x² -14x

Step-by-step explanation:

4x^2 + 28x + 49 = 0

Subtract 3x² and 14x from each sides.

x^2 + 14x + 49 = -3x² -14x

Next step will be factoring.

(x+7)² = -3x² -14x

The Colonel spots a campfire at a bearing N 59∘59∘ E from his current position. Sarge, who is positioned 242 feet due east of the Colonel reckons the bearing to the fire to be N 34∘34∘ W from his current position.
Determine the distance from the campfire to each man, rounded to the nearest foot.
Colonel is about............................ feet away from the fire
Sarge is about............................... feet away from the fire

Answers

Answer:

i. Colonel is about 201 feet away from the fire.

ii. Sarge is about 125 feet away from the fire.

Step-by-step explanation:

Let the Colonel's location be represented by A, the Sarge's by B and that of campfire by C.

The total angle at the campfire from both the Colonel and Sarge = [tex]59^{0}[/tex] + [tex]34^{0}[/tex]

                                           = [tex]93^{0}[/tex]

Thus,

<CAB = [tex]90^{0}[/tex] - [tex]59^{0}[/tex] = [tex]31^{0}[/tex]

<CBA = [tex]90^{0}[/tex] - [tex]34^{0}[/tex] = [tex]56^{0}[/tex]

Sine rule states;

[tex]\frac{a}{Sin A}[/tex] = [tex]\frac{b}{Sin B}[/tex] = [tex]\frac{c}{Sin C}[/tex]

i. Colonel's distance from the campfire (b), can be determined by applying the sine rule;

[tex]\frac{b}{Sin B}[/tex] = [tex]\frac{c}{Sin C}[/tex]

[tex]\frac{b}{Sin 56^{0} }[/tex] = [tex]\frac{242}{Sin 93^{0} }[/tex]

[tex]\frac{b}{0.8290}[/tex] = [tex]\frac{242}{0.9986}[/tex]

cross multiply,

b = [tex]\frac{0.8290*242}{0.9986}[/tex]

  = 200.8993

Colonel is about 201 feet away from the fire.

ii. Sarge's distance from the campfire (a), can be determined by applying the sine rule;

[tex]\frac{a}{Sin A}[/tex] = [tex]\frac{c}{Sin C}[/tex]

[tex]\frac{a}{Sin 31^{0} }[/tex] = [tex]\frac{242}{Sin 93^{0} }[/tex]

[tex]\frac{a}{0.5150}[/tex] = [tex]\frac{242}{0.9986}[/tex]

cross multiply,

a = [tex]\frac{0.5150*242}{0.9986}[/tex]

  = 124.8073

Sarge is about 125 feet away from the fire.

find out what's wrong with this graph

Answers

Answer:

The y-axis is upside down, meaning that instead of the values increasing as they go up, they decrease.

determine each unknown addend ___ + 41=-18

Answers

Answer:

-59

Step-by-step explanation:

x+41=-18

x= -18-41

x = -59

Other Questions
Capitalism has led to prosperity for millions of people.Objective opinion Subjective opinion Timmy is a friend who came by your store after hours to have a beverage and play video games. When Timmy got up to use the restroom in the back of the store, he tripped over a raised piece of floor, causing him to fall and break his nose. You found out about the raised piece of floor yesterday, but you did not fix it because the restroom is for employees only. You owe Timmy: Mario invested $5100 at 13% to be compounded daily. What will be the value of Mario's investment in 2 years? Round your answer to the nearest cent, if necessary. Note: 365 days in a year and 30 days in a month. The anticodon (Select all that apply): a. is a triplet of nucleotides in tRNA b. determines the identity of the amino acid to be added to the peptide chain c. is complementary to the codon d. binds to the codon via hydrogen bonds Compare the value for the inductor when the current was increasing vs decreasing. Which statement matches the expected results. The inductance should be the same regardless of whether the current is increasing or decreasing. The inductance should be greater while the current is increasing. The inductance should be greater while the current is decreasing. after allowing 20 percent discount on the marked price of a radio 15 percent vat is levied on it , if its price become rs 22080 ,what amount was levied in the vat The image formed is 0.25 times the size of the object and 10 cm behind the pinhole. If the height of image on screen is 6 cm what is the distance of the object from the screen? The population distribution of SAT scores is normal with a mean of =500 and a standard deviation of SD=100. For example, what is the probability of randomly selecting an individual from this population who has an SAT score greater than 700? What occurs at the end of a females monthly cycle? The Coat of Arms includes two phrases, "Blessed are the peacemakers" and "Shame to him who evil thinks." Choose one of these phrases and explain why a ruler might want it included in a coat of arms A tour group is going sea diving. Sea level is O feet. The oceanfloor is -18 feet. One diver is already at -11 feet. The tour guideis keeping watch on the deck at 5 feet above sea level directlyabove the diver. What is the distance from the tour guide to thediver? Draw and label a number line to justify your answer. jawaban dari 5x 7 = 13 adalah....... dijawab ya.... An analyst takes a random sample of 25 firms in the telecommunications industry and constructs a confidence interval for the mean return for the prior year. Holding all else constant, if he increased the sample size to 30 firms, how are the standard error of the mean and the width of the confidence interval affected Restriction digest A:ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCCHow many bases are in the second fragment? Investment in human capital is very similar to investing in physical capital. True or false? Explain your answer. Given money demand, by how much would the Moola central bank need to change the money supply to close the output gap? TRUE OR FALSE The Enlightenment in the American Revolution rejected traditional religious, political and social values. The ratio of sales to invested assets, which is also a factor in the DuPont formula for determining the rate of return on investment, is called Rearrange the tiles so that it shows the proper steps of solving this quadratic equation using square property Instruments had retained earnings of at December 31, . Net income for totaled , and dividends declared for were . How much retained earnings should report at December 31, ?