The Bob Buckham Senior Center, a not-for-profit entity, serves a hot meal to senior citizens every Friday evening. All the food is donated by a local supermarket. All the food preparation and serving is done by local volunteers. If the Center had to pay for the food, it would need to spend $10,000 a year. If it had to pay for the food preparation and service, it would need to spend $12,000 a year. How should it report these contributions in its financial statements?

Food | Food preparation and service

a. Disclose in the notes | Disclose in the notes
b. Disclose in the notes | Report $12,000 revenue and expense
c. Report $10,000 revenue and expense | Disclose in the notes
d. Report $10,000 revenue and expense | Report $12,000 revenue and expense

Answers

Answer 1

Answer:

c. Report $10,000 revenue and expense | Disclose in the notes

Explanation:

Not-for-profit entities must report the fair value of all the goods they receive as donations. in this case, they would have to report the $10,000 worth of food received from a local supermarket. But they are not required to report the value of volunteer work, they only have to disclose it on the footnotes of their financial statements.


Related Questions

Morgan Company issues 10%, 20-year bonds with a par value of $720,000 that pay interest semiannually. The current market rate is 9%. The amount paid to the bondholders for each semiannual interest payment is:

Answers

Answer:

$36,000

Explanation:

Calculation for the amount to be paid to the bondholders for each semiannual interest payment

Using this formula

Semiannual interest payment = Face value Amount*Interest Rate*Time

Let plug in the formula

Semiannual interest payment = $720,000*0.10*0.50

Semiannual interest payment = $36,000

The amount paid to the bondholders for each semiannual interest payment is $36,000

If a company would still have a cash flow item even if they rejected potential new Project A, should this particular cash flow item be included in Project A's cash flow analysis?

Answers

Answer: No

Explanation:

When computing a project analysis for a project, only relevant cash flow should be included in the Project's cash flow analysis. Relevant cash-flow are those that will only occur if the project was embarked on.

If the cash flow in question is still going to occur even if the project wasn't initiated as is the case with Project A, it is not a relevant cash-flow and should not be included in the cash-flow analysis.

Perkins Company own 85% of Sheraton Company. Perkins Company sells merchandise to Sheraton Company at 20% above cost. During 2008 and 2009, such sales amounted to $450,000 and $486,000, respectively. At the end of each year, Sheraton Company had in its inventory one-third of the amount of goods purchased from Perkins during that year.
Prepare the workpaper entries necessary to eliminate the effects of the intercompany sales for 2008 and 2009.

Answers

Answer:

2008

Correct Overstatement

Cost of Sales $450,000 (debit)

Revenue $450,000 (credit)

Correct Unrealized Profit in Inventory

Cost of Sales $25,000 (debit)

Inventory $25,000 (credit)

2009

Adjustments of Opening Balances

Retained Earnings $25,000 (debit)

Cost of Sales $25,000 (credit)

Correct Overstatement

Cost of Sales $486,000 (debit)

Revenue $486,000 (credit)

Correct Unrealized Profit in Inventory

Cost of Sales $27,000 (debit)

Inventory $27,000 (credit)

Explanation:

The Sale of merchandise by Perkins Company (Parent) to Sheraton Company (Subsidiary) is an Intragroup transaction since the companies form a group.

This results in the Cost of Goods Sold and Revenue being overstated for each intra-sale transaction and an unrealized profit resulting in the inventory that has not been sold at the end of the period.

The above are the necessary adjustments that are required to correct the overstatement and unrealized profits.

You observe a portfolio for five years and determine that its average return is 11.3​% and the standard deviation of its returns in 19.7​%. Would a​ 30% loss next year be outside the​ 95% confidence interval for this​ portfolio?

Answers

Answer:

-28.1%

Explanation:

Calculation for what would a​ 30% loss next year be outside the​ 95% confidence interval for the​ portfolio

The standard deviation of 95% confident will be 2

The first step is to find the Upper tail using this formula

Upper tail= Average return percentage +(Standard deviation of 95% confident *Standard deviation of its returns)

Let plug in the formula

Upper tail=0.113+(2*0.197)

Upper tail =0.113+0.394

Upper tail=0.507*100

Upper tail =50.7%

Second step is to find the Lower tail using this formula

Lower tail=Average return percentage -(Standard deviation of 95% confident *Standard deviation of its returns)

Let plug in the formula

Upper tail=0.113-(2*0.197)

Upper tail =0.113-0.394

Upper tail=-0.281*100

Upper tail =28.1%

Based on the above calculation the lower tail was -28.1% which means that it wouldn't in any way loss more than the 30% of it value next year outside the​ 95% confidence interval for the portfolio

Crane Company distributes to consumers coupons which may be presented (on or before a stated expiration date) to grocers for discounts on certain products of Crane. The grocers are reimbursed when they send the coupons to Crane. In Crane's experience, 50% of such coupons are redeemed, and generally one month elapses between the date a grocer receives a coupon from a consumer and the date Crane receives it. During 2018 Crane issued two separate series of coupons as follows:

Issued On Total Value Consumer Expiration Date Amount Disbursed as of 12/31/18
1/1/18 $510000 6/30/18 $234000
7/1/18 830000 12/31/18 355000

The only journal entry recorded to date is: debit to coupon expense and credit to cash of $817000. The December 31, 2018 balance sheet should include a liability for unredeemed coupons of:__________

a. $0.
b. $70,000.
c. $184,000.
d. $420,000.

Answers

Answer:

Liability of un-redeemed coupons Pending on December 31, 2018 is $60,000

Explanation:

Coupon already expired issued on Jan 01, 2018      

Coupon issued on 07/01/2018                                 $830,000

Estimated redeemable coupon value - 50%           $415,000

($830,000 * 50%)

Less : Disbursed                                                        $355,000

Liability pending on Dec. 31, 2018                         $60,000

Simon Company's year-end balance sheets follow.
At December 31 2015 2014 2013
Assets
Cash $25,267 $30,131 $31,387
Accounts receivable, net 75,450 50,642 41,435
Merchandise inventory 92,074 68,299 44,128
Prepaid expenses 8,301 8,066 3,418
193,532
Plant assets, net 231,487 215,775
Total assets $432,579 372,913 313,900
Liabilities and Equity
Accounts payable $106,635 $62,392 $41,849
Long-term notes payable secured by
mortgages on plant assets 79,698 84,912 71,453
Common stock, $10 par value 163,500 163,500 163,500
Retained earnings 82,746 62,109 37,098
Total liabilities and equity $432,579 $372,313 313,900
Express the balance sheets in common-size percents.

Answers

Answer:

Simon Company

Common-size percents Balance Sheet as of the years ended December 31 2015 2014 2013:

                                             2015     %         2014         %       2013        %

Assets

Cash                                $25,267   5.8%  $30,131      8.1%  $31,387   10%

Accounts receivable, net 75,450   17.4%  50,642    13.6%   41,435   13.2%

Merchandise inventory    92,074   21.3%  68,299   18.3%   44,128    14.1%

Prepaid expenses               8,301     1.9%     8,066    2.2%     3,418       1.1%

                                        201,092  46.5%  157,138   42.1% 120,368  38.3%

Plant assets, net             231,487  53.5%  215,775   57.9% 193,532  61.7%

Total assets                 $432,579  100%    372,913 100%   313,900    100%

Liabilities and Equity

Accounts payable       $106,635   24.7%  $62,392 16.7% $41,849    13.3%

Long-term notes payable secured by  mortgages

 on plant assets            79,698    18.4%      84,912 22.8%   71,453   22.8%

Total Liabilities           $186,333   43.1%  $147,304  39.5 $113,302   36.1%

Common stock, $10

par value                     163,500    37.8%   163,500 43.8% 163,500   52.1%

Retained earnings         82,746    19.1%      62,109  16.7%  37,098     11.8%

Total liabilities and

 equity                     $432,579    100%   $372,913 100%  313,900   100%

Explanation:

Simon Company's balance sheets in common-size percents shows the relative values of assets and liabilities and equity in numeric and percentage terms to enable comparison.  The company's balance sheet line items are expressed as  percentages of the total, usually the total assets in each period.  From the analysis, the management, investors, and other parties of Simon Company can understand the changes in the line items from year to year, thus making it possible for  Simon Company to undertake a trend analysis.

If the price of steel, an input into the production of automobiles, rises, and at the same time the price of gasoline rises, what will happen to the equilibrium price and quantity of automobiles

Answers

Answer:

a decrease in equilibrium quantity

an indeterminate effect on equilibrium price.

Explanation:

An increase in the price of steel would raise the production cost of cars. as a result the supply curve would shift inwards or to the left. price would rise and quantity would fall.

A rise in the price of gasoline would increase the cost of fuelling one's car. As a result the demand for cars would fall. the demand curve would shift inward. Quantity and price would fall.

Taking these two effects together, there would be a decrease in equilibrium quantity but an indeterminate effect on equilibrium price.

Check the attached image for a diagram explaining the effects of these changes

On July 1, Shady Creek Resort borrowed $250,000 cash by signing a 10-year, 8% installment note requiring equal payments each June 30 of $37,258. What amount of interest expense will be included in the first annual payment

Answers

Answer:

Interest expense = $20,000

Explanation:

Loan Amortization: A loan repayment method structured such that a series of equal periodic installments will be paid for certain number of periods to offset both the loan principal amount and the accrued interest.  

The annual installment is computed as follows:  

Annual installment= Loan amount/annuity factor  

Annual installment is already given as = 37,258 (already given)

Interest payment = interest rate × Loan balance at the beginning of the year

DATA

Interest rate = 8%

Loan balance at the beginning of the year = $250,000

Interest expense = 8%× 250,000 = $20000

Principal paid = Annual installment - Interest = 37,258-20,000 = 17,258 (this  is not required but to explain the concept)

Interest expense = $20,000

A customer owns a long-term negotiable CD. If the customer wishes to tender the CD prior to maturity, the registered representative should inform the customer that:

Answers

Complete Question:

A customer owns a long-term negotiable CD. If the customer wishes to tender the CD prior to maturity, the registered representative should inform the customer that:

A. a prepayment penalty will be charged

B. he or she will receive par value of the principal plus accrued interest

C. the CD may not be redeemed prior to maturity

D. the customer will receive the market value plus accrued interest

Answer:

D. the customer will receive the market value plus accrued interest.

Explanation:

In this scenario, a customer owns a long-term negotiable certificate of deposit (CD). If the customer wishes to tender the CD prior to maturity, the registered representative should inform the customer that the customer will receive the market value plus accrued interest.

Generally, in the stock markets when a customer wishes to withdraw his or her funds on any brokered CD, there are no penalties for such actions or choice. The registered representative should pro-rate the amount of interest earned by the customer over the period of time for the deposit.

Make a list of some typical documentation you would request from a loan applicant and/or the verifications you would perform?

A. Make a list of at least three items that are important to double check before submitting a loan application to underwriting.

B. List at least two things you would be sure to tell a borrower in preparation for closing.

C. List at least three calculations that are typically used during the course of a mortgage loan transaction.

Answers

Answer:

a. Items that are important to double check before submitting a loan application to underwriting:

Personal ID DocumentsProof of IncomePersonal Credit Bureau Report

b. Things you would be sure to tell a borrower in preparation for closing:

Proof of Property Ownership or Guarantee PledgeContact details of 2-3 relatives or guarantors

c. Calculations that are typically used during the course of a mortgage loan transaction:

Loan to Value ratioDebt to Income ratioHouse expense ratio

Explanation:

The following are typical documentation and/or verifications to request from a loan applicant:

(A) 3 Items that are important to double check before submitting a loan application to underwriting are as follows;

Personal ID Documents (for background check)

Proof of Income

Personal Credit Bureau Report

(B) 2 things one would be sure to tell a borrower in preparation for closing are as follows;

Proof of Property Ownership (certificate of ownership)

Contact details of guarantors

(C) 3 Calculations that are typically used during the course of a mortgage loan transaction:

Debt to Income ratioHouse expense ratioLoan to Value ratio

Read more on loan documents:

https://brainly.com/question/24867222

Suppose you own 5% of Coastal Corporation's 400,000 outstanding common shares. The stock was trading for $165 per share before Coastal executives announced a 3-for-2 stock split. After the split, you will own _____ shares worth _____ per share.Group of answer choices

Answers

Answer: 30,000; $110

Explanation:

From the question, we are informed that someone own 5% of Coastal Corporation's 400,000 outstanding common shares and that the stock was trading for $165 per share before Coastal executives announced a 3-for-2 stock split.

The share owned after the split will be:

= 5% × 400,000 × (3/2)

= 0.05 × 400,000 × 1.5

= 30,000

The price after the split will be the current price divided by the split ratio. Tgis will be:

= $165/1.5

= $110

Jay owns Gatsby Islands and wants to convey it to his good friends, Nick and Daisy. Nick lives next door to Jay while Daisy lives across the waters. He conveys an interest in Gatsby Islands "to Nick as tenants by the entirety." Two months later, he makes a corresponding conveyance to Daisy. Jay created the following:_______

a. tenancy in common
b. severalty community property
c. joint tenancy with rights of survivorship
d. tenancy by entirety

Answers

Answer:

Correct Answer:

c. joint tenancy with rights of survivorship

Explanation:

The property Jay owes on Gatsby Island belongs to him but he wishes to share th ownership with his 2 good friends. His conveyance of the message to both which reads "tenants by the entirety" shows that he and his friends has equal ownership and rights to the Gatsby Island property.

In the event that either him or one of the friends dies, the full title of the property automatically passes to the surviving person.

If a corporation has a dividend payout ratio of 75%, the undistributed earnings (25%) will:_________.
A. increase earnings per share.
B. decrease book value.
C. increase capital in excess of par
D. increase retained earnings

Answers

Answer:

D

Explanation:

Retained earnings is what is left of net income after a company has paid out dividends to its shareholders.

As the leader of your newly formed 9-person team, one of your key concerns is that the team performs as a cohesive unit. Which of the following descriptions is most likely to indicate that your team is cohesive?
A. There is very little conflict between team members.
B. Team members prioritize the team’s goals over their own goals.
C. Whenever tackling a new team task, members typically divide into the same 3 subgroups.
D. Team members have no problem working independently or alone.

Answers

Answer:

b. Team members prioritize the team’s goals over their own goals.

Explanation:

Team cohesiveness is mostly seen in teams that perform highly. People in such teams are usually more likely to cooperate and they have an effective way of achieving their set objectives.

Team cohesiveness would have members of a team acting together rather than individually. It is an interpersonal relationship that is alive within members of the group and this pushes and motivates them to participate more and do what is necessary to achieve all of their objectives.

Geese Company utilizes the LIFO retail inventory method. Its cost-to-retail percentage is 60% based on beginning inventory and 64% based on current-period purchases. The company determined that beginning inventory at retail was $200,000 and that during the current period a new layer was added with retail value of $50,000. The cost of ending inventory should be

Answers

Answer:

$152,000

Explanation:

Calculation for the cost of the ending inventory

First step is to calculate the cost-to-retail percentage of the beginning inventory amount

Using this formula

Beginning Inventory =Cost-to-retail percentage*Beginning inventory at retail

Let plug in the formula

Beginning Inventory =60%*$200,000

Beginning Inventory =$120,000

Second step is to calculate current-period purchases percentage of the new layer amount

Using this formula

Current period purchases= Purchases percentage* New layer

Let plug in the formula

Current period purchases=64%*50,000

Current period purchases=$32,000

The last step is to find the cost of the ending inventory using this formula

Ending inventory cost=Beginning Inventory+Current period purchases

Let plug in the formula

Ending inventory cost=$120,000+$32,000

Ending inventory cost=$152,000

Therefore the cost of the ending inventory will be $152,000

When entering a foreign market, Montain stream brewery purchases a manufacturing plant and sets up a new brewery. Instead of using their signature name, the product produced in the foreign market is labeled as “Everest Prak Brew” This is an example of?

Answers

it's an example of brand localization

A salesperson shows his broker an offer for one of his listings that has a good faith deposit in the form of a promissory note. The broker should tell the salesperson that: Group of answer choices

Answers

Answer:

The seller must be informed when the offer is presented that the depositis a promissory note

Explanation:

A good faith deposit is one that is done by a buyer in which conditions are stated that could result in the loss of deposit by the buyer.

It is a deposit made by the buyer to show he intends to complete the payment later.

In this instance if there is a Goodwill deposit in form of a promissory note, the broker needs to be aware.

So that when he is bringing in a client he will consider the already existing deposit.

Deals that offer more deposit or full payment will be considered and the original buyer discarded.

The mode of transportation that results in the lowest transportation cost will also lower total costs for a supply chain.
a) true
b) false

Answers

Answer: False

Explanation:

Transportation is the movement of individuals or goods from one place to another. Supply chain are the steps that are involved before a product will finally get to the consumer.

It should be noted that the mode of transportation that results in the lowest transportation cost will not necessarily lower total costs for a supply chain. This I because transportation isn't the only process involved on supply chain.

TB MC Qu. 6-63 Creswell Corporation's fixed monthly expenses ... Creswell Corporation's fixed monthly expenses are $23,000 and its contribution margin ratio is 63%. Assuming that the fixed monthly expenses do not change, what is the best estimate of the company's net operating income in a month when sales are $78,000

Answers

Answer:

Net operating income= $26,140

Explanation:

Giving the following information:

Fixed costs= $23,000

The contribution margin ratio is 63%.

Sales=  $78,000

First, we need to calculate the contribution margin:

Contribution margin= contribution margin ratio*sales

Contribution margin= 0.63*78,000

Contribution margin= 49,140

Net operating income= 49,140 - 23,000= $26,140

As the workforce becomes more diverse, why does performance appraisal become a more difficult process?

Answers

Answer: The diversification of the employees in the organization will bring about a larger difference between the workers and raters and could invariably lead to bias at the workplace.

Explanation:

Performance appraisal is also called performance evaluation and it is when the performance of a worker in a company is being appraised or evaluated so as to improve efficiency and output.

The diversification of the employees in the organization will bring about a larger difference between the employees and the raters who are rating them. Hence, the above situation can lead to biases and unfairness in the workplace.

[The following information applies to the questions displayed below.]

Allied Merchandisers was organized on May 1. Macy Co. is a major customer (buyer) of Allied (seller) products.

May 3 Allied made its first and only purchase of inventory for the period on May 3 for 2,000 units at a price of $10 cash per unit (for a total cost of $20,000).
5 Allied sold 1,500 of the units in inventory for $14 per unit (invoice total: $21,000) to Macy Co. under credit terms 2/10, n/60. The goods cost Allied $15,000.
7 Macy returns 125 units because they did not fit the customer’s needs (invoice amount: $1,750). Allied restores the units, which cost $1,250, to its inventory.
8 Macy discovers that 200 units are scuffed but are still of use and, therefore, keeps the units. Allied sends Macy a credit memorandum for $300 toward the original invoice amount to compensate for the damage.
15
Allied receives payment from Macy for the amount owed on the May 5 purchase; payment is net of returns, allowances, and any cash discount.

Prepare journal entries to record the following transactions for Allied assuming it uses a perpetual inventory system and the gross method. (Allied estimates returns using an adjusting entry at each year-end.)

Answers

Answer:

                                  Allied Merchandisers

                                        Journal Entries

Date           General Journal                         Debit        Credit

03-May   Merchandise Inventory               $20,000

                     To Cash                                                     $20,000

05-May    Accounts Receivable                 $21,000

                      To Sales                                                    $21,000

05-May     Cost of goods sold                     $15,000

                     To Merchandise Inventory                        $15,000

07-May      Sales Returns and allowances   $1,750  

                      To Accounts Receivable                           $1,750

07-May      Merchandise Inventory               $1,250

                      To Cost of goods sold                                $1,250

08-May      Sales Returns and allowances    $300

                       To Accounts Receivable                            $300

15-May        Cash                                             $18,571

                   Sales Discounts                           $379

                    ($18950*2%)

                         To Accounts receivable                           $18,950

                          ($21000-$1750-$300)

In order to document a business transaction in the accounting records of the company, a journal entry is employed. A journal entry is often made in the general ledger, but it can also be made in a subsidiary ledger and subsequently rolled forward into the general ledger after being summarised.

The journal entry has been attached below:

Allied Merchandisers

                                       Journal Entries

Date           General Journal                         Debit        Credit

03-May   Merchandise Inventory               $20,000

                    To Cash                                                     $20,000

05-May    Accounts Receivable                 $21,000

                     To Sales                                                    $21,000

05-May     Cost of goods sold                     $15,000

                    To Merchandise Inventory                        $15,000

07-May      Sales Returns and allowances   $1,750  

                     To Accounts Receivable                           $1,750

07-May      Merchandise Inventory               $1,250

                     To Cost of goods sold is $1,250

08-May      Sales Returns and allowances    $300

                      To Accounts Receivable                            $300

15-May        Cash                                             $18,571

                  Sales Discounts                           $379

                   ($18950*2%)

                        To Accounts receivable                           $18,950

                         ($21000-$1750-$300)

After then, the general ledger is utilized to produce the company's financial statements.  The idea behind a journal entry is to use double-entry accounting, which requires that every company transaction be recorded at least twice.

For instance, when you make a cash sale, the revenue account and the cash account are both increased. Alternatively, if you purchase items on credit, this raises both the accounts payable and inventory accounts.

Learn more about journal entries here:

https://brainly.com/question/33438461

#SPJ6

A broker is charged with discrimination. The Federal fair housing investigator notices that the Fair Housing Poster is not displayed in the broker's office. The investigator may

Answers

Answer:

charge the broker with discrimination with no further evidence

Explanation:

It is mandatory for a broker who markets dwelling for rent or sale to display fair housing poster in his or her office or at any dwelling meant for rent or sale. This is according to the Department of Housing and Urban development (HUD) that brokers who market dwelling should display such where they can be easily seen by persons who need the service of the broker to list or locate a dwelling or purchase same in a residential area.

The fair housing poster gives assurance to intending clients that the broker do not engage in any unlawful discriminatory services he offers. However, where a broker fails to paste the fair housing poster, he will not be subjected to any penalty but may be charged with discrimination by the federal fair housing investigator.

How would you make a convincing case that open trade in goods and services as well as free flow of foreign direct investment will enhance the well-being of (a) consumers, (b) pro-ducers, and (c) the government of countries? Give specific examples to prove your position.

Answers

Answer:

(a) consumers

Consumers are those who benefit the most from open trade and foreign direct investment. This is because these two economic policies increase the producion and delivery of goods and services, making them cheaper.

(b) producers

While some producers would be affected by open trade, most producers would benefit. Firms are allowed to specialize in producing those goods and services for which they have a competitive advantage, and they can also profit from increased foreign investment.

(c) the government of countries

Governments also benefit from these economic policies. They higher well-being of society means more government credibility, and the higher economic growth means more government revenue in the form of taxes.

The case that open trade in goods and services, as well as free flow of foreign direct investment, should be described below:

Consumers, producers, and government:Consumers are those who benefit the most from open trade and foreign direct investment. While some producers would be affected by open trade, most producers would benefit. Governments also benefit from these economic policies. The higher well-being of society means more government credibility

learn more about the investment here: https://brainly.com/question/16822436?referrer=searchResults

What term is used to identify the difference between the number of units of an item listed on the master schedule and the number of firm customer orders?

Answers

Answer:

Available to promise

Explanation:

Available-to-promise (ATP) refers to a function of a business in which the company provides a response to inquires of the order done by the customer that depended on the availability of the resources. Moreover, the quantities are also available based on the customer request and their delivery on due dates

So, the difference between the number of units listed on the master schedule and the number of customer orders is known as available to promise

How can you assist the ProServices team in serving Pro customers in your
department? Select all that apply.
A. Pull orders for Pro customers in advance and have them ready to pick-up
B. Call Pro customers to maintain relationships and proactively seek out business
C. Monitor inventory levels to make sure key Pro items are in-stock
D. Price match other retailers to give Pro the best price
E. Identify pro customers and introduce them to the ProServices team​

Answers

Answer:

ProServices Team and Pro Customers

Assisting the ProServices Team in serving Pro customers in my department.  Here I have assumed that my department manages and coordinates the relationship with Pro customers:

A. Pull orders for Pro customers in advance and have them ready to pick-up

B. Call Pro customers to maintain relationships and proactively seek out business

C. Monitor inventory levels to make sure key Pro items are in-stock

D. Price match other retailers to give Pro the best price

E. Identify pro customers and introduce them to the ProServices team​.

Explanation:

“Pro” customers are a group of independent contractors, repair remodelers, specialty tradesmen, property management, and facility maintenance professionals who are afflicted to an organization offering ProServices.  They are not the end customers.  Between my organization and the customers, they are middlemen and women who are organized by my ProServices organization to offer specialty services to the general public in a professional manner that  guarantees customer satisfaction and payment to the professionals for services rendered.  In doing this, the ProService organization charges the Pro customers a fixed fee, which is deducted from the payments made by the end-customers.

The Sherman Antitrust Act of 1890 was successful enough in reducing the power of cartels and monopolies that no further legislation to curb monopoly power has ever been needed.

a. True
b. False

Answers

Answer:

False

Explanation:

After the Sherman Antitrust Act of 1890 , the Clayton Act was passed in 1914. the purpose of this act was to strengthen the anti trust law

Jensen performed legal services to assist Balm Co. in accomplishing its initial organization. Jensen accepted 1,000 shares of $5 par common stock in Balm as payment for his services. The Balm shares were not yet publicly traded, but they had a book value of $4 per share. Jensen provided 48 hours of service, which is normally billed at $125 per hour. By what amount should the common stock account increase?

Answers

Answer: $5,000

Explanation:

The Common Stock account of a company will record stock only at the Par Value so that the Balance sheet is more accurate.

As such, the common stock account here will increase by;

= 1,000 * $5 par value

= $5,000

Winston contracts to sell a plot of land called Blackacre to Paris for $500,000. Winston breaches the contract and Paris sues him. Blackacre's reasonable market value at the time of the breach was $525,000. Paris can recover: Group of answer choices only $25,000.

Answers

Answer:

Correct Answer:

C) only $25,000.

Explanation:

In the case between Blackacre and Paris over the piece of land, the value recoverable will be the difference between the original value of the land the the newest value of the land when the breach of contract occurs. Hence, the only amount recoverable by Paris would be $25, 000.

g Sheffield Corp. purchased a truck at the beginning of 2017 for $109200. The truck is estimated to have a salvage value of $3800 and a useful life of 131750 miles. It was driven 23000 miles in 2017 and 31000 miles in 2018. What is the depreciation expense for 2018

Answers

Answer:

$24,800

Explanation:

Calculation for the depreciation expense for 2018 for Sheffield Corp.

Using this formula

Depreciation expense = (Purchased at the beginning-Salvage value/Useful life)* Driven miles

Let plug in the formula

Depreciation expense=($109,200-$3,800/131,750)*31,000

Depreciation expense=($105,400/131,750)*31,000

Depreciation expense=0.80*31,000

Depreciation expense=$24,800

Therefore the depreciation expense for 2018 will be $24,800

Harris Co. is considering a 12-year project that is estimated to cost $900,000 and has no residual value. Harris seeks to earn an average rate of return of 15% on all capital projects. Determine the necessary average annual income (using straight-line depreciation) that must be achieved on this project for it to be acceptable to Harris Co.

Answers

Answer:

annual income = $70,292.52

Explanation:

initial outlay $900,000

in order to determine the net cash flows per year we can use the present value of an ordinary annuity:

PV = annual cash flow x annuity factor

PV = $900,000 annuity factor, 15%, 12 years = 6.1944

annual cash flow = $900,000 / 6.1944 = $145,292.52

annual cash flow = [(revenue - operating costs - depreciation) x (1 - tax rate)] + depreciation

revenue - operating costs - depreciation = annual incometax rate = 0?depreciation = $900,000 / 12 = $75,000

$145,292.52 = annual income + $75,000

annual income = $145,292.52 - $75,000 = $70,292.52

Other Questions
Capitalism has led to prosperity for millions of people.Objective opinion Subjective opinion Timmy is a friend who came by your store after hours to have a beverage and play video games. When Timmy got up to use the restroom in the back of the store, he tripped over a raised piece of floor, causing him to fall and break his nose. You found out about the raised piece of floor yesterday, but you did not fix it because the restroom is for employees only. You owe Timmy: Mario invested $5100 at 13% to be compounded daily. What will be the value of Mario's investment in 2 years? Round your answer to the nearest cent, if necessary. Note: 365 days in a year and 30 days in a month. The anticodon (Select all that apply): a. is a triplet of nucleotides in tRNA b. determines the identity of the amino acid to be added to the peptide chain c. is complementary to the codon d. binds to the codon via hydrogen bonds Compare the value for the inductor when the current was increasing vs decreasing. Which statement matches the expected results. The inductance should be the same regardless of whether the current is increasing or decreasing. The inductance should be greater while the current is increasing. The inductance should be greater while the current is decreasing. after allowing 20 percent discount on the marked price of a radio 15 percent vat is levied on it , if its price become rs 22080 ,what amount was levied in the vat The image formed is 0.25 times the size of the object and 10 cm behind the pinhole. If the height of image on screen is 6 cm what is the distance of the object from the screen? The population distribution of SAT scores is normal with a mean of =500 and a standard deviation of SD=100. For example, what is the probability of randomly selecting an individual from this population who has an SAT score greater than 700? What occurs at the end of a females monthly cycle? The Coat of Arms includes two phrases, "Blessed are the peacemakers" and "Shame to him who evil thinks." Choose one of these phrases and explain why a ruler might want it included in a coat of arms A tour group is going sea diving. Sea level is O feet. The oceanfloor is -18 feet. One diver is already at -11 feet. The tour guideis keeping watch on the deck at 5 feet above sea level directlyabove the diver. What is the distance from the tour guide to thediver? Draw and label a number line to justify your answer. jawaban dari 5x 7 = 13 adalah....... dijawab ya.... An analyst takes a random sample of 25 firms in the telecommunications industry and constructs a confidence interval for the mean return for the prior year. Holding all else constant, if he increased the sample size to 30 firms, how are the standard error of the mean and the width of the confidence interval affected Restriction digest A:ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCCHow many bases are in the second fragment? Investment in human capital is very similar to investing in physical capital. True or false? Explain your answer. Given money demand, by how much would the Moola central bank need to change the money supply to close the output gap? TRUE OR FALSE The Enlightenment in the American Revolution rejected traditional religious, political and social values. The ratio of sales to invested assets, which is also a factor in the DuPont formula for determining the rate of return on investment, is called Rearrange the tiles so that it shows the proper steps of solving this quadratic equation using square property Instruments had retained earnings of at December 31, . Net income for totaled , and dividends declared for were . How much retained earnings should report at December 31, ?