What is the answer for number 2?

What Is The Answer For Number 2?

Answers

Answer 1

Answer:

It has mass but no charge.

Explanation:

The question asks to describe ONE of the subatomic particles that could be found at location X in the model, so you should think of protons and neutrons. Now all of the answers do NOT describe a proton, but the first answer describes a neutron. Neutrons have mass but no charge. Why? The neutron has two down quarks and one up quark, down quarks, have a charge of -1/3, and up quarks have a charge of +2/3. Doing the math, you'd see that (-1/3)2+2/3 is equal to a neutral charge. So a neutron WILL have a mass, but will NOT have a charge, as they are used to hold the nucleus together.

Answer 2

Answer:

the last one

Explanation:


Related Questions

One of the steps to sweeten sour gas using the Claus process is reacting
hydrogen sulfide gas with sulfur dioxide gas to produce water vapour and sulfur.
16 H2S(g) + 8 SO2(g) → 16 H2O(g) + 3 Sg(s)
8.56 kL of hydrogen sulfide at 175 kPa and 250 °C reacts with excess sulfur
dioxide. Calculate the mass, in kg, of sulfur produced.

Answers

The mass, in kg, of Sulfur produced : 2.072 kg

Further explanation

Given

V = 8.56 kL = 8560 L

P = 175 kPa = 1,73 atm

T = 250 + 273 = 523 K

Required

mass of Sulfur produced

Solution

mol of H₂S :

[tex]\tt n=\dfrac{PV}{RT}\\\\n=\dfrac{1.73\times 8560}{0.082\times 523}\\\\n=345.3[/tex]

mol of Sulfur based on mol  H₂S as a limiting reactant( excess Sulfur  dioxide)

From equation, mol ratio  H₂S : S = 16 : 3, so mol S :

[tex]\tt \dfrac{3}{16}\times 345.3=64.74[/tex]

Mass S(Ar = 32 g/mol) :

= mol x Ar s

= 64.74 x 32

= 2071.68 g = 2.072 kg

Answer these three please! Thank you <3333
(I will give brainliest)

Answers

Answer:

Explanation:

21:B 22:B

List 3 particles of an atom (w/their symbol & charge)

Answers

Answer:

there are three fundamental particles of atom

which are :

proton ( positively charged (+) )electron ( negatively charged ( - ) )neutron ( having no charge on it ( neutral ))

Particle Symbol

electron =》e-

proton =》p+

neutron =》n°

How many hydrogen atoms Is needed for C4H8 to become saturated

Answers

Answer:

2 atoms

Explanation:

Because it contain one double bond

Air has
A. a definite volume but not a definite shape
B. a definite shape but not a definite volume.
C. no definite volume or shape.
D. both a definite shape and a definite volume.

Answers

Answer would be neither!

The reason being that it can take the shape and volume of anything.

Answer:

Neither

Explanation:

How would you describe the appearance of homogeneous mixture? A. Homogeneous mixtures do not have a uniform composition. B. Homogeneous mixtures have a uniform appearance. C. Homogeneous mixtures are not distributed evenly. D. Homogeneous mixtures have two phases

Answers

Answer:

i think its c somebody correct me if im wrong. but hope this help

Explanation:

Compare and contrast atoms and molecules. Cite specific examples from the readings, as well as what you may already know, to support your comparison.

Answers

Answer:

The main difference between an atom and a molecule lies in the size: while the atom is the smallest unit into which matter can be divided into any of its states, a molecule is the union of a group of atoms, that is, this composed of several atoms. Thus, for example, a water molecule is composed of two hydrogen atoms and one oxygen atom (H2O). Therefore, it can be said that atoms are the smallest unit in which the chemical elements of the world can be divided, while molecules are the particles of matter that are formed through the combination of these elements.

I Wanted to ask.. it's a weird question I know or maybe it's gonna get reported But
Why is my friend so irritating..​

Answers

Answer:

if hyper its probaly because the have ADHD which is a type of drug that helps people with behavior disorders . the might have ticks wich is something that people can not control.

Explanation:

Structural formula of 2 ethyl, 4 methyl-Heptane​

Answers








Hey this answer question

How many elements, compounds and atoms are in CH3COOH

Answers

CH3COOH is called Acetic acid, also known as ethanoic acid and methane carboxylic acid, is a colorless liquid that has a strong and distinct pungent and sour smell. It has two carbon (C) atoms, four hydrogen (H) atoms and two oxygen (O) atoms. Because it has a carbon in its chemical formula, it is an organic compound

what are all the populations of different species that live in the same area at the same time

Answers

Answer:

The answer is Community  

Explanation:

PLZ HELP!

Why do we use ramps (inclined planes) to help us move objects?

Plz nothing from the internet :D

Answers

Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong.

Which feature does an iron metal have?
O electrons that transfer between atoms to make cations and anions
O a sea of electrons
O firmly bonded electrons
O electrons shared between single pairs of atoms

Answers

Answer:

a sea of electrons

Iron metal has a sea of electrons.

Iron metal is an element which possesses a sea of electrons as a result of it

containing cations which are usually surrounded by electrons which move at

a very fast pace .

This property makes Iron metal to be reactive when exposed to air( oxygen)

and it then forms various compounds such as Iron(II) oxide, Iron(III) oxide and

rust.

Read more on https://brainly.com/question/20466452

In which highlighted section of the periodic table in the diagram provided above are the elements whose atoms have 1 valence electron located?

A) a
B) b
C) c
D) d

Answers

Answer:

B.

Explanation:

I don't really understand this worksheet question.​

Answers

25/2 and 96/X
CROSS MULTIPLY.

2x=2,400.
divide by 2.
x=1,200.

you take the GIVEN MASS of an element, and you put it on top, the coefficient is what it’s over. i believe this is right


The creation of carbon monoxide is an effect. What is one cause?

A. the regrouping of the atoms in table salt

B.the burning of fossil fuels

C.cleaning swimming pools

D.operating a stove

Answers

Answer:

Your answer is going to be B. the burning of fossil fuels

Explanation:

This is because carbon monoxide is extremely toxic for us humans. An example of this could be pollution. Hope this helps! :)

define the clinical thermometer ​

Answers

Answer:

a small medical thermometer with a short but finely calibrated range, for taking a person's temperature.

Answer:

Thermometer which are used in clinical to measure the temperature of human body is called clinical thermometer.

Which statement about anabolism is true?
A. In anabolism, energy is released.
B. In anabolism, energy is absorbed.
C. In anabolism, energy is absorbed and then released.
O
D. In anabolism, energy is released and then absorbed.

Answers

Answer:

i would say B? Im sorry if im wrong

Explanation:

i think that because Catabolic reactions release energy, while anabolic reactions use up energy. Anabolism is the opposite of catabolism.

Answer:

B) In anabolism, energy is absorbed.

what is cell explain in a paragraph

Answers

Answer:

Cells are the basic building blocks of living things. The human body is composed of trillions of cells, all with their own specialised function. Cells are the basic structures of all living organisms. Cells provide structure for the body, take in nutrients from food and carry out important functions.

An object has a mass of 26.94 grams and a volume of 2.568 cubic centimeters. What material is it likely to be
made of?
Substance iron gold silver copper
Density (g/cm) 7.874 19.32 10.49 8.92
a. Silver
c. Iron
b. Gold
d. Copper

Answers

Answer:

a) silver

Explanation:

Given data:

Mass of object = 26.94 g

Volume of object = 2.568 cm³

Which subject is this = ?

Solution:

Formula:

d = m/v

by putting values

d = 26.94 g/ 2.568 cm³

d =  10.49 g/cm³

Densities of objects: g/cm³

iron =  7.874

gold = 19.32

silver =  10.49

copper = 8.92

Thus, given object is silver.

How many
How long does it take to go
from a new moon to a third
quarter?

Answers

Answer:

about three weeks

Explanation:

because after a full moon, which is about 21 days, it comes to a third quarter moon

Explain five physical and/or chemical properties that you need to consider for the substances before using them as construction materials for buildings

Answers

Answer:  There are many properties of a metal which is taken into consideration when it is used for construction

Explanation:

The properties can be physical, chemical, et cetera. The physical properties that is considered are:

1. Durability:  It can be defined as the property of the material to withstand the atmospheric pressure and other factors.

2. Density: The ratio of mass by volume of a material (homogeneous material) is called as density.

3. Fire resistance: The ability of the material to withstand in fire without changing its size or shape.

4. Weather resistance: The ability of the material to withstand the weather which could be variable round the year.

5.Water absorption: The ability of the material to absorb water and retain it.

can someone please help me solve this? i dont understand this problem :(

Answers

Answer:

–4020 KJ

Explanation:

The following data were obtained from the question:

H₂(g) + F₂(g) —> 2HF(g) ΔH = –536 KJ

Next, we shall determine the mass of H₂ that reacted from the balanced equation to produce –536 KJ of heat energy. This can be obtained as follow:

Molar mass of H₂ = 2 × 1 = 2 g/mol

Mass of H₂ from the balanced equation = 1 × 2 = 2 g.

Summary:

From the balanced equation above,

2 g of H₂ reacted to produce –536 KJ of heat energy.

Finally, we shall determine the heat change produced by the reaction of 15 g of H₂. This can be obtained as follow:

From the balanced equation above,

2 g of H₂ reacted to produce –536 KJ of heat energy.

Therefore, 15 g of H₂ will react to produce = (15 × –536)/2 = –4020 KJ of heat energy.

Thus, the heat change for the reaction is –4020 KJ

What needs to be known about an object in order to determine its kinetic energy.


P.S Please help I need to answer this question for my pendulum experiment.

Answers

Answer:

we need to know it's

mass and velocity

Explanation:

then use the formula of kinetic energy

Answer:

Mass and velocity (or motion).

Explanation:

KE=(1/2)mv^2.

The kinetic energy of an object is the amount of work (expended energy) that's required to move (or more accurately, to accelerate) the object to a specific velocity.  So, if you know the mass of the object, and you know it's current velocity, you can determine it's kinetic energy with the formula above.

Which safety procedure could prevent an accident?
using a fire extinguisher
using glass without chips or cracks
smelling a mixture of chemicals
getting a bandage out of the first aid kit when bleeding

Answers

I believe it would be the second one. Because it is asking how to prevent it before it happens so it would not be a or d and c would not be good because you do not want to smell chemicals.

Answer:

B

Explanation:

Write one paragraph to summarize Strengths and Weaknesses of Acids and Bases.

Answers

Answer:

Explanation: I can't give you the answer you with the sentence but i will help you the best i can

One qualitative measure of the strength of an acid or a base solution is the pH scale A logarithmic scale that relates the concentration of the hydrogen ion in solution.

What three types of particles make up an atom? What are their charges?

Answers

Answer:

Protons, neutrons, and electrons are the three main subatomic particles found in an atom. Protons have a positive (+) charge. An easy way to remember this is to remember that both proton and positive start with the letter "P." Neutrons have no electrical charge.

Answer:

Protons, positive charge

Neutrons, neutral

Electrons, negative charge

Explanation:


When 3243. grams of iron (III) chloride are reacted with 511.8 grams of hydrosulfuric acid, which is the limiting reactant?
2 FeCl3 + 3 H2S -----> Fe2S3 + 6 HCl

Answers

Answer:

Hydrosulfuric acid will act as limiting reactant.

Explanation:

Given data:

Mass of iron(III) chloride = 3243.0 g

Mass of hydrosulfuric acid = 511.8 g

Limiting reactant = ?

Solution:

Chemical equation:

2FeCl₃ + 3H₂S       →       Fe₂S₃ + 6HCl

Number of moles of iron(III) chloride:

Number of moles = mass/molar mass

Number of moles = 3243.0 g/ 162.2 g/mol

Number of moles = 20 mol

Number of moles of hydrosulfuric acid:

Number of moles = mass/molar mass

Number of moles = 511.8 g/ 34.1 g/mol

Number of moles = 15 mol

Now we will compare the moles of both reactant with products

                      FeCl₃          :          Fe₂S₃

                       2                :            1

                      20               :          1/2 ×20 = 10

                      FeCl₃          :            HCl

                       2                :              6

                      20               :          6/2 ×20 = 60

                      H₂S             :          Fe₂S₃

                       3                :            1

                      15               :          1/3 ×15 = 5

                      H₂S            :            HCl

                       3                :              6

                      15                :          6/3 ×15 = 30

Hydrosulfuric acid producing less number of moles of product thus, it will act as limiting reactant.

 

5. Describe the effects of photons of light on an electron of the hydrogen atom

Answers

Answer:

How do atoms give off light?

Atoms emit light when they are heated or excited at high energy levels. The color of light that is emitted by an atom depends on how much energy the electron releases as it moves down different energy levels. ... It shows the electron moving down energy levels.

Explanation:


Matter that is made up of only one kind of Atom

Answers

Answer:

elements

Matter that has only one kind of atom is called an element. Gold, copper, oxygen, and mercury are examples of elements. Most matter is made up of two or more different kinds of atoms that are chemically combined. This kind of matter is called a compound.

Explanation:

Answer:

Element

Explanation:

This is the answer because:

1) All matter is made up of substances called elements.

2) Matter that iis made up of only one kind of Atom is called an Element.

Hope this helps! :D

Other Questions
The Venn diagram below shows some of the services provided by national and state governments.Which service completes the Venn diagram? (3 points)A. Raise and collect taxesB. Declare war and make peaceC. Make marriage lawsD, Coin and print money Solve: 68 x = 14 ( please i really need these super fast thank you! ) happy new year. eeeeeeeee e I need help ASAP please Which sentence is best structured to present two ideas of equal importance?A. Since NASA was founded, it has sent more than 250 astronautsinto space.B. The mission of NASA is to explore outer space.C. Some people think that NASA should focus on exploring theuniverse, but others believe that building a colony on the moon isthe most important goal, even though it will be difficult.D. NASA is known for sending humans to the moon, but the famousspace program has also sent an unmanned spaceship to Mars. DETERMINE THE MISSING SIDE Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT What caused the original creation of the Universe? How do we find out? Create a flow chart that shows the hierarchy of the US Banking Systems. TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia List two equivalent numbers to 0.50 Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make? You know I never approved of it, pursued Utterson, ruthlessly disregarding the fresh topic.My will? Yes, certainly, I know that, said the doctor, a trifle sharply. You have told me so.Well, I tell you so again, continued the lawyer. I have been learning something of young Hyde.The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. I do not care to hear more, said he. This is a matter I thought we had agreed to drop.The Strange Case of Dr. Jekyll and Mr. Hyde,Robert Louis StevensonWhere in the plot is this passage found?the expositionthe rising actionthe falling actionthe resolution How do blood types react in a transfusin ? Tarshiss article is mainly about A. the U.S. Navys secret missions B. the construction of the Titanic C. creatures that thrive in the deep seaD. one mans quest to find the Titanic