What is the measure of angle B?​

What Is The Measure Of Angle B?

Answers

Answer 1

Answer:

b = 60

Step-by-step explanation:

The sum of the angles of a triangle are 180

80+40+b = 180

Combine like terms

120+b =180

Subtract 120 from each side

b = 180-120

b = 60

Answer 2

Answer:

60°

Step-by-step explanation:

Recall that all triangles have an interior angle sum of 180. In other words:

[tex]\angle A+\angle B +\angle C = 180[/tex]

Plug in the angle values we know:

[tex](80)+(40)+\angle B = 180\\120+\angle B =180\\\angle B = 60\textdegree[/tex]


Related Questions

New York City is a popular feild trip destination. This year the senior
class at High School A and the senior class at High School B both
planned trips there. The senior class at High School A rented and filled
8 vans and 4 buses with 220 students. High School B rented and filled 12 vans and 4 buses with 228 students. Every van had the same
number of students in it as did the buses. How many students can a
van carry? How many students can a bus carry?​

Answers

Step-by-step explanation: look so if you have

shcool A its 8v+4b=12

and

School B: 12v+4b= 16

since both classes used 4 busses we can use elimination by subtracting the A class Equation from the b class equation to solve from v for its value Then, use either equation and the now found value for v to solve for b.

You should find part of the process to be

12v+4b-(8v+4b)=12-16 which shows the van holds only a few people even before continuing the solution.

Answer -4

can i please have help please?? Is 32,120 equal to 3.212×10 to the 4 power?

Answers

Answer:

Yes

Step-by-step explanation:

3.212 x 10^4

=> 3.212 x 10000

=> 32.12 x 1000

=> 321.2 x 100

=> 3212 x 10

=> 32120 x 1

=> 32120

Answer:

Yes

Step-by-step explanation:

In scientific notation, the power is the number of times you move the decimal place to the right.

3.212 x 10^4 is equivalent to 32,120 when you move the decimal place 4 times to the right.

So, 32,120 is equivalent to 3.212 x 10^4

PLEASE HELP ASAP!! (: One link below. I WILL NAME BRAINLIEST!! 30 points (: Make sure to show ur work. One who shows work and gets correct, gets title of Brainliest!! (:

Answers

Answer:

1)  502.65"

2) 367.57 yd

3)  141.37'  

4) 471.24'

Step-by-step explanation:

Formula: volume of a cylinder = πr²h

1) v= πr²h                     2) v= πr²h                      

  v= π x 4² x 10                v= π x 3² x 13

  v=  502.65"                   v= 367.57 yd

3) v= πr²h                       4) v= πr²h

    v=  π x 3² x 5                 v= π x 5² x 6

     v= 141.37'                       v= 471.24'

I hope this helped

Answer:

1. 502.5 [tex]in^{3}[/tex]

2. 367.38 [tex]yd^{3}[/tex]

3. 141.3 [tex]cm^{3}[/tex]

4. 471 [tex]cm^{3}[/tex]

Step-by-step explanation:

The solution to finding the volume of a cylinder is: [tex]\pi r^{2} h[/tex].

They give us a diameter but no radius. So, we just need to divide the diameter, 8, by two. That leaves us with a radius of 4.

We can also see that the height of the first cylinder is 10. That gives us all our information to find the volume!

3.14 · [tex]4^{2}[/tex] · 10 = 502.5

So, the volume of the first cylinder is 502.5[tex]in^{3}[/tex]

This, hopefully explains how to find the volume of the rest of the cylinders!! :)

Hope this helps!! <3

PLS HELL I WILL GIVE BRAINLIST AND A THANK YOU

Answers

Answer:

[tex]\huge \boxed{20}[/tex]

Step-by-step explanation:

The angles add up to 90 degrees.

x + 2x + x + 10 = 90

Combine like terms.

4x + 10 = 90

Subtract 10 from both sides.

4x = 80

Divide both sides by 4.

x = 20

Answer:

x = 20

Step-by-step explanation:

Since we are solving for x let's create an equation

The whole thing is equal to 90 degrees, so we can keep that on one part of the equation

x + 2x + (x + 10) = 90

First let's add all of the x's together making it 4x + 10 = 90

Now subtract 10 from each side 4x = 80

Lastly, divide 4 on each side

x = 20

Is the relation a function?

Answers

Answer:

Yes it's a function

Step-by-step explanation:

ANSWER:
Yes it is a function.

Consider the function f(x)=|-x-3/2|-1

Answers

Answer:

x1(1 is on the bottom)= -5/2 (fraction), x2(2 on the bottom)=-1/2 (fraction)

Step-by-step explanation:

Write the phrase as an expression. Then evaluate the expression when x = 5.
6 more than the product of 8 and a number x
Expression:
When x = 5, the value of the expression is

Answers

Answer:

6 + 8x

46

Step-by-step explanation:

1. Write the expression

6 + 8x

2. Plug in 5 for x

6 + 8(5) → 6 + 40 = 46

Answer:

Expression=8x+6

The value of expression=46

You buy 3 pairs of pants for $19 each and 5 shirts for $10 each. Which of the following is a good estimation of how much money you spent?

Answers

Answer

19 X 3= 57

10 X 5= 10

57 + 10=

Therefore your answer is $67

Hope this helps! (づ ̄3 ̄)づ╭❤~

Step-by-step explanation:

Solve the equation 1) 4.3^x+1 = 27+9^x
2) 3^x+5= 3^x+3+8/3

Answers

Answer:

Step-by-step explanation:

4*3^x+1=27+(3^2)^x

(3^2)^x=(3^x)^2

3^x=t

4t+1=27+t^2

t^2-4t+27-1=0

t^2-4t+26=0

delta=4^2-4*1*26=16-84=-68<0

the  equation has not real solutions

Two similar figures have sides in the ratio of 2:3. Ita side of the smaller triangle has a length of 7, what is
the length of the corresponding side of the other triangle?

Answers

Answer:

10.5

Step-by-step explanation:

2/3=7/x

2x=21

x=21/2=10.5

70000000000x50000000000000

Answers

Answer:

Step-by-step explanation: Multiply

70000000000*50000000000000=3.5e+24

whats the squareroot of 72 needs to be simplified

Answers

Answer: 6√2

Step-by-step explanation: The easiest way to do this problem is to factor 72 as 2 · 36, then recognize 36 as a perfect square, 6 · 6.

There's no need to factor further because the 6's pair up

so a 6 comes out of the radical leaving a 2 inside.

So our answer is 6√2.

Always be on the lookout for perfect squares!

Work is attached below.

Evaluate the expression for the given value of the variable. −3x3, when x = 4

Answers

Answer:

The answer is - 192

Step-by-step explanation:

The expression

- 3x³

To find the value of the expression when

x = 4 substitute the value of x that's 4 into the expression

We have

- 3(4)³

= - 3( 64)

The final answer is

- 192

Hope this helps you

What is the equation for the line of symmetry in this figure?

Answers

Hey there! I'm happy to help!

A line of symmetry is a line that cuts a figure in half so that it is the same on both sides. We cannot do a vertical line because one side is different than another. We could do a horizontal line where y=3 the whole time. This would cut the shape in half so it is the same on both sides.

Therefore, the equation for the line of symmetry in this figure is y=3.

Have a wonderful day! :D

The horizontal line y = 3 is the required equation of line that makes the symmetric figure.

What is a line of symmetry?

A line of symmetry is a line that splits a figure in two and makes the two halves identical.

In the given figure,

One side is different from the other, we are unable to draw a vertical line.

A horizontal line with y = 3 throughout could be drawn. This would split the form in half, making both sides identical.

Therefore, line y = 3 is the equation of line that will make figure symmetric.

To know more about Line of symmetry on :

https://brainly.com/question/4032475

#SPJ2

Which statement compares the two numbers correctly? (2 points) Fifty-seven thousand, eight hundred and twenty-two hundredths ________ fifty-seven thousand eight hundred and three tenths Select one: a. Fifty-seven thousand eight hundred and twenty-two hundredths < fifty-seven thousand eight hundred and three tenths b. Fifty-seven thousand eight hundred and twenty-two hundredths > fifty-seven thousand eight hundred and three tenths c. Fifty-seven thousand nine hundred and three tenths > fifty-seven thousand eight hundred and twenty-two hundredths d. Fifty-seven thousand eight hundred and three tenths = fifty-seven thousand eight hundred and twenty-two hundredths

Answers

Answer:

a. Fifty-seven thousand eight hundred and twenty-two hundredths < fifty-seven thousand eight hundred and three tenths

Step-by-step explanation:

In numbers it is written in the order

Th    H    Tens    Units    Decimal   Tenths   Hundredths  Thousandths

57    8      0          0          .                0             22

57     8      0         0          .                 3

This could be simply explained that the if we make compare the numbers before the decimal they are same but after the decimal we can analyze

3/10 and 22/100

Converting them into decimals we get

0.3 and 0.22

therefore 0.3 is greater than 0.22

so Choice a is only correct .

a. Fifty-seven thousand eight hundred and twenty-two hundredths < fifty-seven thousand eight hundred and three tenths

Answer: The person above me is correct

explanation:

I said that because i don't want no one saying that i copied them

Web site W receives orders for its products every day. What is the standard deviation of the numbers of orders that Web site W received daily for the past 5 days?(1) The average (arithmetic mean) number of orders that Web site W received per day for the past 5 days is equal to the greatest of the numbers of orders that Web site W received daily for the past 5 days.(2) The range of the numbers of orders that Web site W received daily for the past 5 days is equal to 0.

Answers

Answer:

The standard deviation is zero

Step-by-step explanation:

Given that:

Web site W receives orders for its products every day.

What is the standard deviation of the numbers of orders that Web site W received daily for the past 5 days?

If :

(1) The average (arithmetic mean) number of orders that Web site W received per day for the past 5 days is equal to the greatest of the numbers of orders that Web site W received daily for the past 5 days.

SO, IF the average (arithmetic mean) is greatest , therefore, this implies that the  number of orders per day remains the same. Then the standard deviation will be zero because the set of values for the number of orders per day for the five days is the same.( i.e contains identical numbers).

.(2) The range of the numbers of orders that Web site W received daily for the past 5 days is equal to 0.

The range is the difference between the greatest value and the smallest value.

i.e

greatest value -  smallest value = 0

greatest value =  smallest value

Therefore , the range is zero and the standard deviation will remain the same (zero)

andy is making floor plans for a tree house using a scale 1in to 2ft he wants to make the floor of the tree house have a length of 8ft. how many inches should he show for this distance on his floor plan

Answers

Answer:

Andy should represent the 8 feet long floor on the floor plan with a dimension of 4 inches

Step-by-step explanation:

The  scale of the tree house plan is given as 1 in. to 2 ft,

Therefore we have a scale of 1/2 in. of the floor plane is equivalent to 1 ft. in actual dimensions

Given that Andy wants the floor to make the tree house floor to have a length of 8 ft., let the dimension of the floor plan of the house floor be x, we have;

[tex]\dfrac{\frac{1}{2} \ inches \ plan }{1 \ feet \ actual} =\dfrac{x \ inches \ plan}{8 \ feet \ actual}[/tex]

[tex]x \ inches \ plan =\dfrac{\frac{1}{2} \ inches \ plan }{1 \ feet \ actual} \times 8 \ feet \ actual = 4 \ inches[/tex]

Therefore, Andy should represent the 8 feet long floor on the floor plan with a dimension of 4 inches.

Adam has the difference between two-thirds of bretts book and two thirds of charlies books.If brett has 72 books and charlie has 72 books how many books does adam have

Answers

Answer:

48

Step-by-step explanation:

Adam has 2/3 of books that brett and charlie have : 2/3 of 72 wich is 48

Please answer quickly i will give you brainliest if its correct- it has to be a simplified fraction please

Answers

Answer:

[tex]\large \boxed{{r=\frac{1}{9}}}[/tex]

Step-by-step explanation:

x and y are proportional.

[tex]y=rx[/tex]

Let x = 45 and y = 5.

[tex]5=r(45)[/tex]

Solve for r (constant of proportionality).

Divide both sides by 45.

[tex]\displaystyle \frac{5}{45} =r[/tex]

Simplify and switch sides.

[tex]\displaystyle r=\frac{1}{9}[/tex]

Please explain and help

Answers

Answer:

y=-x+2  

Step-by-step explanation:

it is linear equation y=mx+b two points (0,2),(1,1)

find m ( slope)=y2-y1/x2-x1 ⇒1-2/1-0⇒-1

y=mx+b choosea point from graph :(0,2)\when x =0 the y=b=2

y=-x+2  

pls help with mathmatics

Answers

Answer:

answer is B . in order to make the triangles congruent the angle A and angle A'

Answer:

a and  b

Step-by-step explanation:

AB=a just incase it cant be seen​

Answers

Answer:

Below

Step-by-step explanation:

● vector ED:

Vector ED = a since the Vectors ED and AB are colinear and have the same sense.

● vector CD:

Vector CD = -b since the vectors FA and CD are colinear but have opposite senses.

● Vector FB:

Vector FB = a+b

Using Chasles relation, we can express FB as the sum of the Vectors FA and AB.

● Vector BE:

Vector BE= -2b

The vectors BE and FA are colinear but have different senses. BE has a magnitude that is the double of FA's one.

●Vector EF:

Again using Chasles, relation we can express EF as the sum of the vectors FA and AB.

Vector EF= a+b

● Vector CF:

Vectors CF and AB are colinear but have opposite senses. The distance CF is the double of AB.

So: Vector CF=a+b

ANYONE PLEASE HEEEEEEELLLLLLLPPPPPP!!!!! WILL GIVE BRAINLIEST!!!
Question 4(Multiple Choice Worth 1 points) (06.04 LC) Choose the correct simplification of the expression −3x2(5x − 4x2 − 6). −7x4 + 2x3 − 9x2 12x4 − 15x3 + 18x2 12x4 + 15x3 + 18x2 −12x4 + 15x3 − 18x2

Answers

Answer:

12x⁴ - 15x³ + 18x²

Step-by-step explanation:

1. distribute -3x²

-3x² • 5x = -15x³

-3x² • -4x² = 12x⁴

-3x² • -6 = 18x²

2. combine terms and put in descending order (standard form)

12x⁴ - 15x³ + 18x²

Answer:

12x⁴ - 15x³ + 18x²

Step-by-step explanation:

1. distribute -3x²

-3x² • 5x = -15x³

-3x² • -4x² = 12x⁴

-3x² • -6 = 18x²

2. combine terms and put in descending order (standard form)

12x⁴ - 15x³ + 18x² correct answer would be this

Can someone please tell me how to solve this problem??!! I literally have to go back in math if I don’t pass this HELP!!

Answers

Answer:

          D.   270° < φ < 360°

Step-by-step explanation:

Imagine coordinate system

I quarter is where x>0 and y>0  {right top} and it is (0°,90°)

II quarter is where x<0 and y>0  {left top} and it is (90°,180°)

III quarter is where x<0 and y<0  {left bottom} and it is (180°,270°)

IV quarter is where x>0 and y<0  {right bottom} and it is (270°,360°)

Now, we have an angle wich vertex is point (0,0) and one of its sides is X-axis and the second lay at one of the quarters.

For the trig functons of an angle created by this second side always are true:

In first quarter all functions are >0

in second one only sine

in third one: tangent and cotangent

and in fourth one: cosine

{You can check this by selecting any point on the second side of angle and put it's coordinates to formulas of these functions:

[tex]\sin \phi=\dfrac y{\sqrt{x^2+y^2}}\,,\quad \cos \phi=\dfrac x{\sqrt{x^2+y^2}}\,,\quad \tan\phi=\dfrac yx\,,\quad \cot\phi=\dfrac xy[/tex]  }

So:

sinφ<0  ⇒ III or IV quarter

tanφ<0  ⇒ I or IV quarter

IV quarter  ⇒  φ ∈ (270°, 360°)

WILL MARK BRAINLIEST HELP ASAP The student's in Roberto's school are painting a mural that will be 8 feet by 15 feet. First they make a scale drawing of the mural with a scale of 2 feet:5 feet. What are the length and width of the scale drawing in feet?

Answers

Answer:

4ft and 3ft

Step-by-step explanation:

Real mural: 8ft by 15ft

Scale: 2ft by 5ft

Length and width of scale drawing> 8t / 2ft= 4ft (length

                                                         >15ft/ 5ft= 3ft(width)

ANSWER 4FT BY 3FT

prove that [tex]2/\sqrt{3} cosx + sin x= sec(\pi /6-x)[/tex]

Answers

Answer:

sec(π/6 - x) = R.H.S = 2/(√3cosx + sinx)  = L.H.S.

Step-by-step explanation:

sec(π/6 - x) = 1/cos(π/6 - x)

Using compound angle formula,

cos(A - B) = cosAcosB + sinAsinB where A = π/6 and B = x.

So, cos(π/6 - x) = cos(π/6)cosx + sin(π/6)sinx , cosπ/6 = √3/2 and sinπ/6 = 1/2

cos(π/6 - x) = cosπ/6cosx + sinπ/6sinx = (√3/2)cosx + (1/2)sinx

sec(π/6 - x) = 1/cos(π/6 - x)

= 1/(√3/2)cosx + (1/2)sinx = 2/(√3cosx + sinx)

= L.H.S

So, sec(π/6 - x) = R.H.S = 2/(√3cosx + sinx)  = L.H.S

Given the right triangle below, if AB = 4 and BC = 4, find AC.
A
B
C

Answers

The length of AC is found using the Pythagorean theorem which is a^2+b^2=c^2.

In this case your equation would look like 4^2+4^2=c^2.
Four to the power of two is 16 so 16+16=c^2.
16+16=32
32=c^2
Root 32 = c

Length AC is root 32.

AC will be 4√2 when AB = 4 and BC = 4, in the given right triangle.

What is Pythagoras' Theorem?

According to Pythagoras' Theorem, in a right triangle, the square of the length of the longest side, that is, the hypotenuse, that is, the side opposite to the right angle is equal to the sum of the squares of the lengths of the other two sides.

How to solve the question?

In the question, we are given a right triangle, with sides AB = 4 and BC = 4.

We are asked to find AC.

To find AC, we will use the Pythagoras theorem, according to which, we can write:

AC² = AB² + BC²

or, AC² = 4² + 4²,

or, AC² = 16 + 16,

or, AC² = 32,

or, AC = √32,

or, AC = √(16 * 2) = 4√2.

Therefore, AC will be 4√2 when AB = 4 and BC = 4, in the given right triangle.

Learn more about Pythagoras' Theorem at

https://brainly.com/question/231802

#SPJ2

A number is three times another number. The difference of these two numbers is 10. Find these number.​

Answers

Answer:

5,15

Step-by-step explanation:

let the numbers be x and y

but y = 3x

3x - x = 10

2x = 10

x = 5

Answer:

[tex]\Large \boxed{\sf 15 \ and \ 5}[/tex]

Step-by-step explanation:

Let the first number be x.

Let the second number be y.

x is 3 times y.

Difference of x and y is 10.

[tex]x=3y[/tex]

[tex]x-y=10[/tex]

Put x as 3y in the second equation.

[tex]3y-y=10[/tex]

Combine like terms.

[tex]2y=10[/tex]

Divide both sides by 2.

[tex]y=5[/tex]

Plug y as 5 in the first equation.

[tex]x=3(5)[/tex]

Multiply.

[tex]x=15[/tex]

The two numbers are 15 and 5.

A library building is in the shape of a rectangle. Its floor has a length of (3x + 5) meters and a width of (5x − 1) meters. The expression below represents the area of the floor of the building in square meters: (3x + 5)(5x − 1) Which of the following simplified expressions represents the area of the floor of the library building in square meters? (5 points)

Answers

Answer:

(16x + 8)m²

Step-by-step explanation:

area of a rectangle = 2length + 2width

=2(3x + 5) + 2(5x-1)

=6x + 10 + 10x - 2

=(16x + 8)m²

What is the value of the expression below when w = 6 and x = 2?
9w + 9x​

Answers

put 6 instead of w and 2 instead of x
9(6)+ 9(2)
54+ 18
= 72
STEPS:
First add 6 into the w and 2 into the x.
You end up getting 9(6)+9(2). Then you fo 9x6 and 9x2. You get 54 and 18. Then you add them to get 72.
ANSWER:
72
Other Questions
The domain of this function is {-12, -6, 3, 15}. y=-2/3x+7 Complete the table based on the given domain. The balance sheet of Cattleman's Steakhouse shows assets of $86,000 and liabilities of $14,400. The fair value of the assets is $89,400 and the fair value of its liabilities is $14,400. Longhorn paid Cattleman's $82,920 to acquire all of its assets and liabilities. Longhorn should record goodwill on this purchase of: Help !!!! Thank you!!!! i will give brainliest and 5 stars if you help ASAP A person, with his ear to the ground, sees a huge stone strike the concrete pavement. A moment later two sounds are heard from the impact: one travels in the air and the other in the concrete, and they are 0.50 s apart. The speed of sound in air is 343 m/s, and in concrete is 3000 m/s.Required:How far away did the impact occur? Predict what will happen to the following lung volumes and capacities during strenuous exercise. Assume that you are comparing from a baseline of normal resting respiration.Lung Volume or Capacity Predicted change from resting baseline : Use Increase, Decrease or No ChangeTLC (total lung capacity)No changeVC (Vital capacity)IC (Inspiratory capacity)FRC (Functional residual capacityTV (Tidal volume)IRV (Inspiratory reserve volume)ERV (Expiratory reserve volume)RV (Residual volume) Capitalism has led to prosperity for millions of people.Objective opinion Subjective opinion Timmy is a friend who came by your store after hours to have a beverage and play video games. When Timmy got up to use the restroom in the back of the store, he tripped over a raised piece of floor, causing him to fall and break his nose. You found out about the raised piece of floor yesterday, but you did not fix it because the restroom is for employees only. You owe Timmy: Mario invested $5100 at 13% to be compounded daily. What will be the value of Mario's investment in 2 years? Round your answer to the nearest cent, if necessary. Note: 365 days in a year and 30 days in a month. The anticodon (Select all that apply): a. is a triplet of nucleotides in tRNA b. determines the identity of the amino acid to be added to the peptide chain c. is complementary to the codon d. binds to the codon via hydrogen bonds Compare the value for the inductor when the current was increasing vs decreasing. Which statement matches the expected results. The inductance should be the same regardless of whether the current is increasing or decreasing. The inductance should be greater while the current is increasing. The inductance should be greater while the current is decreasing. after allowing 20 percent discount on the marked price of a radio 15 percent vat is levied on it , if its price become rs 22080 ,what amount was levied in the vat The image formed is 0.25 times the size of the object and 10 cm behind the pinhole. If the height of image on screen is 6 cm what is the distance of the object from the screen? The population distribution of SAT scores is normal with a mean of =500 and a standard deviation of SD=100. For example, what is the probability of randomly selecting an individual from this population who has an SAT score greater than 700? What occurs at the end of a females monthly cycle? The Coat of Arms includes two phrases, "Blessed are the peacemakers" and "Shame to him who evil thinks." Choose one of these phrases and explain why a ruler might want it included in a coat of arms A tour group is going sea diving. Sea level is O feet. The oceanfloor is -18 feet. One diver is already at -11 feet. The tour guideis keeping watch on the deck at 5 feet above sea level directlyabove the diver. What is the distance from the tour guide to thediver? Draw and label a number line to justify your answer. jawaban dari 5x 7 = 13 adalah....... dijawab ya.... An analyst takes a random sample of 25 firms in the telecommunications industry and constructs a confidence interval for the mean return for the prior year. Holding all else constant, if he increased the sample size to 30 firms, how are the standard error of the mean and the width of the confidence interval affected Restriction digest A:ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCCHow many bases are in the second fragment?