What is the recursive rule for the following arithmetic sequence?

-7, -4, -1, 2, 5, …

Answers

Answer 1

Answer:

Recursive rule for arithmetic sequence = an = a[n-1] + 3

Step-by-step explanation:

Given arithmetic sequence;

-7, -4, -1, 2, 5, …

Find:

Recursive rule for arithmetic sequence;

Computation:

Let a1 = -7

So,

⇒ a2 = a1 + 3 = -4

⇒ a3 = a2 + 3 = -1

⇒ a4 = a3 + 3 = 2

⇒ a5 = a4 + 3 = 5

So, the recursive formula is

⇒ an = a[n-1] + 3

Recursive rule for arithmetic sequence = an = a[n-1] + 3


Related Questions

A burrito chain offers a choice of pork, chicken, beef, or veggie burritos. Each burrito also comes with a choice of either rice or beans and either hot or mild salsa.

Answers

Answer:

16

Step-by-step explanation:

4 option: Pork, chicken, beef, or veggie burritos.

and for each of the 4 options: rice, beans, hot or mild salsa.

4x4=16

Example:

Pork with rice

Pork with beans

pork with hot salsa

pork with mild salsa

etc.

Pork: 4 possibility

Chicken: 4 possibility

Beef: 4 possibility

Veggie burritos: 4 possibility

4+4+4+4=16

Hope this answer help you.


Select the correct answer from each drop-down menu.
Consider this expression.
-312 – 241 – 36

Answers

Answer:

[tex][-3](x + [\ 6 \ ])(x+ [ \ 2 \ ])[/tex]

(-3, 6 , 2) or (-3 , 2 , 6)

Step-by-step explanation:

[tex]-3x^2 -24x - 36\\\\-3(x^2 + 8x + 12)\\\\-3(x^2 + 6x + 2 x + 12 )\\\\-3(x(x+6) + 2(x+6))\\\\-3(x+6)(x+2)[/tex]

when turned about it’s axis of rotation, which shape could have created this three-dimensional object

Answers

Answer:

c

Step-by-step explanation:

Answer: A would be the answer

Step-by-step explanation:

What'e More
A. Independent Activity 1
Determine the following numerical values for each alasses using table 5 below​

Answers

Class mark : 37-41

Independant variable is the classes

Another Brainliest/35pt Question to toss at yall

Answers

Answer:

6/14 and 15/35

Step-by-step explanation:

Hope this helps :) mark me brainliest plz :)

Earth contains water and oxygen molecules. Each mass is given below. Which has the greater mass? Explain how you know.

water = 2.99 × 10-26 kg

oxygen = 2.66 × 10-26 kg

Answers

Answer:

The water molecule has the greater mass because 2.99 is greater than 2.66. After comparing the exponents, which are the same, the coefficients are compared to determine the molecule with the greater mass.

Step-by-step explanation:

hii lol I need friend

Answer:

The water molecule has the greater mass because 2.99 is greater than 2.66. After comparing the exponents, which are the same, the coefficients are compared to determine the molecule with the greater mass.

Step-by-step explanation:

its right just trust

If S lies between R and T, RT=21, RS=2X+5, and ST=3x-4. Find RS and ST

Answers

The answer is c so pick it so I can get answers

Answers:

RS = 13

ST = 8

==================================================

Explanation:

S is between R and T. I'm assuming also that S is on line RT.

If that's the case, then by the segment addition postulate, we can say  RS+ST = RT.

In other words, the longest segment RT is broken into two smaller pieces RS and ST (not necessarily equal but they may be). Gluing the pieces back together should get us the original longest segment.

---------------

Apply substitution and solve for x.

RS+ST = RT

(2x+5)+(3x-4) = 21

(2x+3x)+(5-4) = 21

5x+1 = 21

5x = 21-1

5x = 20

x = 20/5

x = 4

--------------------

If x = 4, then,

RS = 2x+5 = 2*4+5 = 13ST = 3x-4 = 3*4-4 = 8

Then notice how RS+ST = 13+8 = 21, which is is the length of RT

This confirms that RS+ST = RT is true and it confirms our answers.

What is the value of X please help

Answers

Answer:

x= 20

Step-by-step explanation:

The sum of the angles of a triangle are 180 degrees

x+5  + 7x-5   + x  =180

Combine like terms

9x = 180

Divide by 9

9x/9 = 180/9

x = 20

hope this helps! Feel free to clarify

A school bus can hold a maximum of 45 students. The correct inequality for this word problem is b ≤ 45. Why did I use ≤ not < in this problem?

Answers

because it can still hold 45, if you did the other it meant it couldn’t hold 45

Answer:

This sign ≤ means greater than or equal to

but, this sign < means the number which is in the side is only greater

That why the sign ≤ is used

My this answer might be wrong , because in b ≤ 45 , I am confused from where the letter " b " came from .

A certain quadratic function has x-intercepts at 2 and 3. What are the x-coordinates of its vertex?
a)7/2
b)1/2
c)3/2
d)5/2

Answers

1/2 b . explained - puzzle it down

Answer:

D

Step-by-step explanation:

The equation is going to by

y = (x - 2)(x - 3)         Multiply to remove the brackets.

y = x^2 - 2x - 3x + 6

y = x^2 - 5x + 6       Now what you are going to do is complete the square.

y = (x^2 - 5x  +  __ ) +6

Take - 5

Divide it by 2 = -5 / 2

and square it = (-5 / 2)^2 = 25/4

Put this result inside the brackets.

y = (x^2 - 5x + 25/4 ) + 6               Now subtract 25/4 after the 6

y = (x^2 - 5x + 25/4) + 6 - 25/4

y = (x - 5/2)^2 - 1/4

The x coordinate of the vertex  is 5/2

You could also do this by using x = -b/2a = - -5/2*1 = 5/2

Use a number line to help you find the sum of -24+8

Answers

Answer:

-16

Step-by-step explanation:

When adding a negative and a positive number, you need to keep in mind that your are essentially adding.

so if I have a number line

-24, -23, -22, -21, -20, -19, -18, -17, -16, -15, -14,,,,

you will start at -24 and will go up the number line (to the right) 8 times and that should get you your answer.

How is 6.8 million written in scientific notation? 6.8 * 10 7 or 6.8 * 10 6

Answers

Answer:

6.8 x 10*6

Step-by-step explanation:

Answer:

hey im sorry for using this, but there's nothing else. which one was right???/ im stuck

Step-by-step explanation:

Cheryl is taking an online test that gives her instant results. After answering 16 questions, the test revealed that 10 were answered correctly. She
then answered I consecutive questions correctly and achieved her goal of 80% accuracy. Write an equation that can be used to determine
how many questions she answered correctly to reach her goal.


Help ;-;

Answers

Y=5(3/2)^x is this model exponential growth,decay or neither ?

A bag contains red and blue marbles, such that the probability of drawing a blue marble is 37.5%

An experiment consists of drawing a marble, replacing it, and drawing another marble. The two draws are independent.

What is the probability that both of the marbles drawn are blue?

a.
24%
c.
14%
b.
39%
d.
0

Answers

I think answer should be d. Please give me brainlest let me know if it’s correct or not okay thanks bye

What is the value of b - c if a = 18, b= 27, and c= 11?
O 16
O 11
0 9
0 29​

Answers

Answer: 16

Step-by-step explanation: 27-11=16

Answer:

16

Step-by-step explanation:

b-c

=27-11

=16

I hope this is helpful :)

The graph below is the graph of a function true or false

Answers

Answer:

you did not add a picture so i cannot help you i am very deeply sorry so sorry i apologize baahhahahahahahahahahahahahah

Step-by-step explanation:

A meat pie contains chicken and turkey in the ratio 4: 1. The pie contains 200g of chicken.
How much turkey is in the pie?

Answers

How much turkey is in the pie?

The mass of the turkey in the pie is 1/4 of the weight of the chicken

200/4 = 50 grams

Help me I will give you brain list if you answer this first

Answers

0 is the answer :)))

Please help it's urgent!Pls

Answers

Answer:

c may bbethe most accurate one l m 55% sure

Answer:

Its c fs :)

Step-by-step explanation:

Its c because x should be the exponent gl and hope this helps :)

PLEASE HElP WILL GIVE BRAINLIEST
Scenario 1: You flip a coin twice.
Scenario 2: An ice cream stand serves three flavors of ice cream: Vanilla, Chocolate, and Mint with a choice of chocolate sprinkles or rainbow sprinkles. (You’ll have to redraw the tree diagram to fill it in.)

Answers

Answer:

there u go sweetie

Step-by-step explanation:

hope it helps

Solve this URGENT! Differentiation

Answers

Instead of using the quotient rule, you can first expand y :

y = (4x - 1)^2 / x ^2 = (16x ^2 - 8x + 1) / x ^2 = 16 - 8/x + 1/x ^2

Then the derivative is

dy/dx = -8/x ^2 - 2/x ^3

The tangent to the curve at (-1, 25) then has a slope or gradient of

dy/dx = -8/(-1)^2 - 2/(-1)^3 = -6

Which of the follwing are true statements about a 30-60-90 triangle?​

Answers

Answer:

A and E

Step-by-step explanation:

The ratio of the hypotenuse to the shorter leg to the longer leg is 2:1: root 3

Answer:

A. and E.

Step-by-step explanation:

The length of the hypotenuse is always double the length of the shortest leg and you can find the long leg by multiplying the short by the square of 3.

Graph the information presented in the table. Use that graph to predict the week that revenue will equal expenses for this small company.
Note: Revenue and Expenses are drawn on the vertical axis and Month is on the horizontal axis.
Week 6
Week 7
Week 5
Week 8

Answers

Week 6 is what your looking for

The graph of g(x) is a translation of y = 37.
Which equation represents g(x)?
O g(x) = 3/x- 4
5
O g(x) = 3/x+4
4
3
O g(x) = 3x +1.5
2
ox
1
O g(x) = 3-1.5
-10-8-6-4-24
6
8 10
X
3

Answers

Answer:

I think its C but I'm not sure

Step-by-step explanation:

I'm so sorry if it is wrong!!

Option D is correct, the equation represented by the function g(x) is  ∛x - 1.5.

The graph of g(x) is a translation of y =∛x

We have to find the equation which represents the g(x).

if x=9 then the value of y is 3 in the f(x).

For the translation of the graph y = ∛x would be in the form g(x) = ∛(x - h) + k, where (h, k) represents the horizontal and vertical shifts of the graph, respectively.

There is a vertical shifts in the translation.

As we observe the function when x is 9 the y value is decreased by 1.5.

So the function g(x) would be ∛x - 1.5.

Hence, the equation represented by the function g(x) is  ∛x - 1.5.

To learn more on Functions click:

https://brainly.com/question/30721594

#SPJ7

Drag the tiles to the correct boxes to complete the pairs.
The function (x) is represented by this table of values

Answers

Answer:

Step-by-step explanation:

Average rate of change of a function between interval x = a and x = b is given by,

Average rate of change = [tex]\frac{f(b)-f(a)}{b-a}[/tex]

Average rate of change of the function in the interval [-4, -2]

= [tex]\frac{f(-2)-f(-4)}{-2-(-4)}[/tex]

= [tex]\frac{0-(-12)}{-2+4}[/tex]

= 6

Average rate of change in the interval [-2, 1]                                                                            

= [tex]\frac{f(1)-f(-2)}{1-(-2)}[/tex]

= [tex]\frac{3-0}{1-(-2)}[/tex]

= 1

Average rate of change in the interval [-3, 1]

= [tex]\frac{f(1)-f(-3)}{1-(-3)}[/tex]

= [tex]\frac{3-(-5)}{1+3}[/tex]

= 2

Average rate of change in the interval [-4, 0]

= [tex]\frac{f(0)-f(-4)}{0-(-4)}[/tex]

= [tex]\frac{4-(-12)}{0-(-4)}[/tex]

= 4

-3x =36 what is x I am confused

Answers

The answer is x = -12

A coordinate plane with 2 lines. The first line is labeled y equals f(x) and passes through (negative 1, 2), (0, 2), and (2, 2). The second line is labeled y equals g(x) and passes through (negative 0.5, negative 2), points at (0, negative 1), and (1, 1). The lines intersect at (1.5, 2).
Use the graph to determine the input value for which f(x) = g(x) is true.

Answers

Answer:

x=2/3

Step-by-step explanation:

Most of that information is unnecessary. Just plug in the values of f(x) and g(x) into the equation where they are equal to each other and solve.

-3x+4=2

-3x=-2

3x=2

x=2/3


[tex]solve[/tex]
solve this please​

Answers

9x² - 225 = 0

(3x - 15)² = 0

or

(3x + 15) (3x - 15) = 0

75 + ( - 50 ) + 250 + (- 150) + 50 = 175 ft A. What three numbers in the equation represent in an increase in elevation? B. Use the same sign to add these three integers together. C. What two numbers in the equation represent a decrease in elevation? D. Use the sign to add these two integers together. E. Add the resulting integers to determine the sum of the equation that describes the hikes in engage in elevation.​

Answers

Answer:

Below.

Step-by-step explanation:

A. 75, 250 and 50.

B.  75+250+50 = 375.

C. -50 and -150.

D.  -50 + -150 = -200.

E.  375 - 200 = 175.

Which number is between 7.17 x 10^4 and 8.17 10^5 A. 6.92 x 10^4 B. 7.2 x10^9 C. 7.57 x 10^3 D. 8.053 x 10^4

Answers

Answer:

D. 8.053 x 10^4

Step-by-step explanation:

Given :

7.17 x 10^4 and 8.17 10^5

The number in between the two Given numbers should be greater Than 7.17*10^4 but less than 8.17*10^5

A. 6.92 x 10^4 - this is less than 7.17 * 10^4 ; hence doesn't fit in

B. 7.2 x10^9 - this is greater than both values, hence, doesn't fit in

C. 7.57 x 10^3 - this is less than 7.17*10^4 ; hence does not fit in

D. 8.053 x 10^4 - this fits in as it is greater than 7.17*10^4 and less than 8.17*10^5 ; hence, it is the correct answer.

Other Questions
Can someone please simplify this?? Which of the following describes an achievement of the Babylonian Empire? g(x)= -16x2 + 64x + 80 where x is the number of seconds after the rocket is launched. The function can also be written in factored form as g(x) = -16 (x + 1)(x - 5). What is the y-intercept of the function? What does it represent? help plz ??????????????????????????? What is an equation of the line that passes through the point (8,-5) and is parallelto the line 5x + 4y = 24? when carbonates react with acids fizzing occurs.what does the fizzing indicate? A clinical trial tests a method designed to increase the probability of conceiving a girl. In the study 678 babies were born, and 339 of them were girls. Use the sample data to construct a 99% confidence interval estimate of the percentage of girls born. Based on the result, does the method appear to be effective? Eight cards are labeled with numbers 2,3,4,5,7,9,10,11 respectively. One card is selected. What is the probability that the card is a prime number? A metal is made from copper, zinc and lead in the ratio 13:6:1 respectively. The mass of zinc is 90kg. Calculate the mass of the metal Please help Describe two types of commercial agriculture and identify geographic regions and climate zones where they are practiced Q1.what is irragation You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA What is the polypeptide sequence of this sense strand? Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ASAP!!!!!!!!!!!!A marble bag contains 10 red marbles, 19 yellow marbles, and 29 green marbles. What is the % composition of each color marble in the bag? (2)pepelelellelrle 1.8. Assess how posting or forwarding humiliating and offensive materialto other people may affect the person who is posting. Which of these sentences is grammatically correct? (1 Point) A. My friend and myself are late today. B. I told myself that it was just a shadow. C. She expects myself to bring lunch for her. D. Myself can clean the blackboard in the morning. For the line segment whose endpoints are X (1, 2) and Y (6, 7), find the x coordinate for the point located 1 over 3 the distance from X to Y. Factor this trinomial completely. 2x2 + 6x + 4 O A. 2(x-2)(x + 1) B. 2(x + 2)(x+1) c. 2(x + 2)(x-1) D. 2(x-2)(x - 1) Mitzi learned the concept of classical conditioning for the first time in her psychology class. It took her about 60 minutes to thoroughly learn the process. Three weeks later, she had an exam in that class that covered classical conditioning. As she studied for that part of her exam, she realized it took her about 60 minutes to understand it once again. Which of the following is true of Mitzi based on this scenario?A. Based on the relearning technique, her savings score was 100%.B. After calculating Mitzi's savings score, it is clear that she maintained about 60% of what she learned the first time around.C. It can be ascertained that Mitzi learned about half of the material the first time around.D. It is evident that she did not maintain any of the original learning in her long-term memory.E. Unfortunately, Mitzi only retained about 10% of the knowledge the first time she learned about classical conditioning. Why did the South's General Lee change his plans, and how were his new plans different?