You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA What is the polypeptide sequence of this sense strand? Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-*

Answers

Answer 1

Answer:

* (Stop) - Arg - Cys - Phe - Ala - Gly - Pro - Cys - Gly - Asn - Lys - Pro - Phe - Ile - Phe - Ile

Explanation:

This question involves gene expression, which consists of transcription and translation. The process of transcription involves synthesis of mRNA from DNA template as follows:

DNA - mRNA

ATT - UAA

GCC - CGG

ATG - UAC

AAA - UUU

CGC - GCG

CCC - GGG

GGT - CCA

ACA - UGU

CCA - GGU

TTG - AAC

TTC - AAG

GGC - CCG

AAA - UUU

TAA - AUU

AAA - UUU

TAA - AUU

Using the codon chart, each mRNA codon is translated into an amino acid as follows:

* (Stop) - Arg - Cys - Phe - Ala - Gly - Pro - Cys - Gly - Asn - Lys - Pro - Phe - Ile - Phe - Ile


Related Questions

What Are the similarities and differences among the different patterns of inherited

Answers

Answer:

Inheritance patterns differ for genes on sex chromosomes (chromosomes X and Y) compared to genes located on autosomes, non-sex chromosomes (chromosomes numbers 1-22). This is due to the fact that, in general, females carry two X chromosomes (XX), while males carry one X and one Y chromosome (XY).

Explanation:

pls mark as brainlist

in what direction air in the southern hemisphere deflects due to coriolis effect?
a.)left
b.)right
C)left and right
d.)neither left or right

Answers

Answer : a.) left

Air is deflected to the left in the southern hemisphere.
Because the Earth rotates on its axis, circulating air is deflected toward the right in the Northern Hemisphere and toward the left in the Southern Hemisphere. This deflection is called the Coriolis effect.
Answer: left

Which term best describes the plasma membrane?


Which term best describes the plasma membrane?

Static
Dynamic
Impermeable
Rigid

Answers

Answer:

The plasma membrane, also called the cell membrane, is the membrane found in all cells that separates the interior of the cell from the outside environment. ... The plasma membrane consists of a lipid bilayer that is semipermeable. The plasma membrane regulates the transport of materials entering and exiting the cell.

Dynamic term describes the plasma membrane. So, the correct option is (B).

What is Plasma membrane?

Plasma membrane also known as cell membrane is a membrane found in all cells that separates the interior of the cell from the external environment. The plasma membrane consists of a lipid bilayer that is semi-permeable that regulates the transport of materials entering and exiting the cell.

This membrane is called a selectively permeable membrane because it controls the movement of substances in and out of the cell, which means that the plasma membrane allows certain materials to pass through it, while at the same time it prevents other materials from entering through it. Plasma membrane is dynamic in nature.

Thus, Dynamic term describes the plasma membrane. So, the correct option is (B).

Learn more about Plasma membrane, here:

https://brainly.com/question/2091722

#SPJ6

5. What are the lessons did you learn after reading the news clip that can be
helpful for you if in case you meet an accident similar to the Ozone Disco
Tragedy?​

Answers

I learned that it can be the things he’s thinking about

The Ozone Disco tragedy is considered one of the worst fire tragedies in history and occurred in the Philippines.

What was the Ozone Disco tragedy?

The Ozone Disco tragedy makes reference to a fire that occurred in a disco in the Philippines in March 1996.

This devastating tragedy occurred in Quezon City and ends with the life of 162 individuals.

The Ozone Disco tragedy is believed to be caused by an electrical fire, thereby we can learn about the importance of regularly controlling electric devices.

In conclusion, the Ozone Disco tragedy is considered one of the worst fire tragedies in history and occurred in the Philippines.

Learn more about the fire tragedies here:

https://brainly.com/question/20343938

#SPJ2

The prime mover of the elbow extension is the

Answers

Answer:

triceps brachii muscle

The prime mover of elbow extension is the triceps brachii muscle, and is assisted by the much smaller anconeus muscle. All anterior (front) arm muscles cause elbow flexion. These muscles are the biceps brachii, brachialis and brachioradialis.

Explanation:

thank me later

Answer:

the other person is correct

Q6. In mice, the allele for black hair color is (B) dominant to that for brown (b), the allele for
short hair (H) is dominant to that for long hair (h). The gene for hair color and length are not
linked (i.e. they are on separate chromosomes).
One colony (colony A) of mice was pure breeding for short hair; a second colony (colony B) was
pure breeding for long brown hair.

a. A male from colony A was mated with a female in colony B.
i.
Give the genotype of the male from colony A and the genotype of female in
colony B. (2mks)
ii.
These two mice were crossed and produce a large number of offspring (F1).
Construct punnet squares to show this result (3mks)
iii.
Give the genotypes and phenotypes (ratio) of this F1 generation (2mks)
Genotypes:
Phenotypes:

Answers

Answer:

The correct answer is -

A (i) a male from colony A HH and female from colony B bbhh

(ii) the offspring will be heterozygous for short brown hair

(iii) genotype 100%  Hhb, phenotype - 100% short brown hair

Explanation:

It is given that parent one is from Colony A that is pure breeding for short hair which means p1 is HH and parent 2 is from colony B that is pure breeding for long brown hair that means p2 is bbhh.

Cross between HH and bbhh

Gemetes : H, H, and bh, bh,

Punnet:

       bh     bh

H    Hhb    Hhb

H    HhB    Hhb

Thus, the offspring will be heterozygous for short brown hair

14. What is the exoskeleton of an arthropod composed of?
Calcium
Chitin
Lead
Magnesium

Answers

Chitin, the exoskeleton is composed of a hard chitin.

Answer:

chitin

Explanation:

Question 24 Multiple Choice Worth 3 points)
(04.02 MC)
Marine biotechnology can be used for cleaning oil spills through biodegradation. What animals do you think would be most directly affected by this?
10
•Animals flying over the area
•Animals living in the sea grass
•Animals living near the surface
•Animals living in the mud on the seafloor

Answers

Answer:

Animals living near the surface

Answer:

The answer would be C, Animals living near the surface

Explanation:

Define "CFU.” Why is this term used instead of simply using "cell count"?​

Answers

that are used to prevent the growth of specific microbes or it simply lacks be calibrated to a viable cell count to express microorganisms as CFU/ml, CFU stands for Colony Forming Units, a microbiology term used to quantify how unit-cfu-colony-forming-unit-cfu-ml-cfu-g-cell-count-microbial- counting.

Which of the following statements is true about dna
A. Amino acids chains form dna
B. None of the above
C. Uracil is present in dna in place of thyamine
D. The site of transcription is within the nucleus

Answers

Answer:

D. The site of transcription is within the nucleus

Explanation:

this is because the process of DNA is converted into RNA

This requires a protein called RNA polymerase. It will copy certain regions of DNA and convert them into RNA (this occurs in the nucleus) and then this RNA goes to the cytoplasm, where it will be translated into a protein.

Therefore, its D.

How many isomers does hexane have (C⁶H¹⁴)

Answers

Answer:

Five.

Explanation:

There are five isomers that is present in hexane (C⁶H¹⁴) which consist of n- hexane, 2- methyl pentane, 3- methyl pentane, 2, 3-dimethylbutane and 2, 2- dimethylbutane. 2- methyl pentane is also known as Isohexane while on the other hand, 2, 2- dimethyl butane also known as Neohexane. These isomers have the same molecular formula which is C6H14, and having the same molecular weight which is 86.

How is the 3rd line of defense (adaptive immunity)
different than the first two?

A)It gives a specific, targeted response.
B)It prohibits pathogens from entering the body.

Answers

A) ↑ see the search above

What is the driving force behind adaptative evolution?
A.better regulation of body heat
B.more efficient digestion
C.increased reproductive success
D. increased size

Answers

The answer is c. That seems more logical.

since 1880, the average global temperature has risen by how many degrees?

a . 10 degrees celsius
b . almost 1 degree celsius
c . 5 degrees celsius
d . 0 degrees celsius

Answers

Answer:

B: almost 1 degree Celsius

Explanation:

Trust me it’s correct

Which chemical powers vesicular transport?


Which chemical powers vesicular transport?

Sodium
Water
ATP
Adenine

Answers

vesicular transport use ATP energy as their power source

Use ATP as the power source

What happens when light hits the pigment in photosystem II?
Thylakoid membrane
Photosystem 11
Light
Inner space
Water-
splitting
enzyme

Answers

The water is essentially the bi product

Answer:

D. It sets off a reaction that moves energy through the proteins of the thylakoids membrane.

Explanation:

please help ill give brainliest :)) A coach travels from the station to the beach, a distance of 430 km away in 7 hrs. The coach is only allowed to travel at a maximum speed of 95 km/h. Did the coach break the speed limit?

Answers

Answer:

No he did not break the speed limit

Explanation:

430÷7=61.43mph

Which of the following is the most likely reason for a population to decrease?

there is less competition for same resource
the number of prey suddenly increases
the number of predators suddenly decreases
the number of predators suddenly increases

Answers

Answer:

the number of predators suddenly increases

Give me Brainiest answer? Its free!

Answer:

The last one

Explanation:

Its the last one because if there are more predators that means they have to not only fight for food but fight for themselves to stay alive.

description of human trafficking from 2016 to 2019 in communities ​

Answers

Human trafficking has shown a record-high number of cases during the year 2016.the number number of cases recorded in 2016 had jumped to over 25,000

I WILL GIVE 100 POINTS
Describe types of unmanned space exploration technology.
· Orbiters

· Fly-bys

· Landers

· Rovers

· Describe Voyager 1 and what is was designed to explore


· Describe Cassini-Huygens and what is was designed to explore


· Describe Spirit/Opportunity/Curiosity and what is was designed to explore


· Describe the Hubble Telescope and what is was designed to explore

Answers

Answer:

voyager 1 was a probe that was designed to explore the outer limits of our solar system and possibly make it to the neighboring solar system

Which element is considered the most versatile element in living organisms and why?

Answers

Answer:

carbon

Explanation:

Because it can bond with many elements of form complex.

All living organisms contain carbon in their body, because carbon is essentially the element of life. It can form up to four covalent bonds, and therefore can make so many complicated molecules while still being stable at the same time.

Substances that can explode are
considered
A. stable
B. corrosive
C. reactive
D. toxic

Answers

C. Reactive

An explosion is essentially some form of reaction, typically chemical reaction, occurring between substances to create the burst. One element reacts with another to create the explosion.

What makes a predator different from a parasite?

A predator has a long relationship with its food.
A predator kills its food organisms faster.
A parasite has a brief relationship with its food.
A parasite kills its food organisms faster.

Answers

A predator kills its food organisms faster

O aglomerado de moléculas orgânicas, revestido por uma película de moléculas de água e que, na opinião de alguns cientistas, pode ser um dos primeiros passos rumo à origem da vida, chama-se: *

(a) Aminoácido.

(b) Enzima.

(c) Micro-organismo.

(d) Coacervado.

(e) Proteína.​

Answers

Setup:


Answer: Ingles

How can you drop two eggs the fewest amount of times, without them breaking?

Answers

Answer:

yes yes i have seen this before,let me guess its from go.ogle

from calculating how thick and strong the shell is i prefer using a egg with a born baby inside becasue it takes energy from divideing cells thus making it lighter and less likly to break and they can stand a weight of 130 pound weight without breaking thus 6 inches to 8 inches will be the answer

i prefer ostrich eggs and make sure to get younger birds they have harder eggs

thus you can keep doing it and 3 out of 10 egg shall break this is real math so ya

Explanation:

Which of the following statement is correct?

Enzymes activators are molecules that bind to the enzymes and increase enzyme activity.
Enzymes inhibitors are molecules that bind to the enzymes and increase enzyme activity.
Enzymes activators are molecules that bind to the enzymes and decrease enzyme activity.
Enzymes activators are molecules that bind to the enzymes and either increase or decrease enzyme activity.

Answers

Enzymes activators are molecules that bind to the enzymes and increase enzyme activity..

enzymes inhibitors decreases the enzyme activity

Answer:

enzymes activators are molecules that bind to the enzymes and increase enzyme activity

Explanation:

Enzyme activators are molecules that bind to enzymes and increase their activity. They are the opposite of enzyme inhibitors.

to separate hucks and grains in field
a) tailor
b) grocer
c) farmer
d) watchman​

Answers

Answer:

C

Explanation:

Comment its correct or not correct please


1. The diagram to the right represents events that occur during sexual
reproduction. The stages labeled A, B, and Care necessary to ensure that
the offspring will inherit
1. half of their chromosomes from each parent
2. double the amount of chromosomes from each parent
3. pairs of chromosomes from each parent
4. double the amount of chromosomes from one parent

Answers

half of their chromosomes from each parent

Explanation: you get half of your chromosomes from each of your parents

g DNA polymerase is used in PCR to cut DNA sequences into fragments that can then be inserted into vectors. true of false

Answers

Answer:

False

Explanation:

The answer is False.

The DNA polymerase is an enzyme that adds nucleotide bases to the growing chain during the elongation process of DNA replication. It is also utilized in the Polymerase Chain Reaction process to synthesize and amplify the DNA of interest.

Polymerase Chain Reaction is primarily carried out to amplify a DNA of interest in order to be able to study it in careful detail. Cutting of DNA into fragments is carried out by restriction enzyme and this is only done during genetic engineering when a foreign gene is to be inserted into a genome.

Nuclear power plants produce large amounts of

Answers

Answer:

Nuclear reactors are, fundamentally, large kettles, which are used to heat water to produce enormous amounts of low-carbon electricity. They come in different sizes and shapes, and can be powered by a variety of different fuels.

Explanation:

Hope this helps!! :))

Other Questions
answer plz answer plz Hello I need the answer fast pls The tennis courts are 3 blocks west and 2 blocks south of Miguels house. The bike path is 5 blocks east and 2 blocks south of Miguels house. How many blocks are the tennis courts from the bike path? If the height of the pyramid were increased to 512 ft and the height to base area ratio of the pyramid were kept constant, by what percentage would the volume of the pyramid increase Part 2 of whats due in a few minutes!! What was one significant outcome of the thirty years war 3Solve for x.X =82035 Is there anything we as a society can do to prevent these pandemic from occurring Each Friday, the sixth grade students in Mr. Shin's physical education class spend the first five minutes doing crunches. Instead of keeping track of the weekly total number of crunches, Mr. Shin keeps track of how they do compared to the week before, and then records the result as a positive or negative number. Record the number for each of the following:Ben did 10 more crunches this week than last week. What number would Mr. Shin record?Gail did 8 less crunches this week than last week. What number would Mr. Shin record?Nathaniel did the same number of crunches this week as last week. What number would Mr. Shin record? My mom is making me do prayice and i need the answer for this thanks very much Hello, Please help me :D thank you! Ben growled at the man who parked too close to his car. He was always guarding his prized possession. Dont get too close or he might bite! Which figure of speech, or literary device, does the author use in the passage? personification extended metaphor epic simile allusion 10.1 The imperfect Complete the sentence with the imperfect form of the verbs from the word bank. Two words will not be used: caminar, poder, sentirse, ser, tener, vivir.1: Anoche ___ las diez y media cuando por fin sali del hospital. 2: Mis compeneras de trabajo y yo ___ muy casandas 3: Tambien ___ hambre.4: Nosotros ___ a ir a mi casa para comer unos sandwiches. Which of the following is the best definition of narrator?one who has a sense of personality about a charactera person who tells a true or fictional storya person who does not know the thoughts, feelings, and ideas of a character as they occurone who has complete and total awareness, understanding, or knowledge Industrialization resulted in what changes to American society?economic growth and increased urbanizationimmigration and an increase in workers' benefitsthe growth of public education and urbanizationincreased opportunities for skilled workers and women's equality What are factors that militate against the acquisition and development of reading skills among students who are deaf What is the square inchesA.51 square inches B. 90 square inches C.100 square inches D.190 square inches Por qu razn se fomenta la inmigracin Europea? - Cul es la relacin entre el ttulo y el contenido del acta? - Cul es el tema de la reunin? - Qu fundamentos presentan las/los participantes? y= x+4 what is the answer? Cal Lury owes $21,000 now. A lender will carry the debt for five more years at 6 percent interest. That is, in this particular case, the amount owed will go up by 6 percent per year for five years. The lender then will require that Cal pay off the loan over the next 13 years at 9 percent interest. What will his annual payment be