When writing headlines, it is always better to

a
Write as few words as possible.
b
Fill the space you are given as much as possible.
c
Be as descriptive and detailed as you can.

Answers

Answer 1

Answer:

It should be C

Explanation:

This is because you need a catchy headline to grab people's attention


Related Questions

What is the purpose of the Bill of Rights?

to limit the rights of individual citizens
to limit the rights of individual citizens

to inspire the governments of other nations
to inspire the governments of other nations

to guarantee freedoms that belong to every citizen
to guarantee freedoms that belong to every citizen

to explain the procedure for amending the Constitution

Answers

Answer:

C). to guarantee freedoms that belong to every citizen

Explanation:

'The Bill of Rights' is a federal document that was primarily designed to grant basic civil rights as well as liberties to each and every citizen of the United States. It is the first out of ten amendments of the United States' Constitution that 'guarantees the freedom of speech, liberty, religion, press, petition, and assembly to its citizens.' Thus, it explains the types of freedom granted to the citizens of the United States as per their constitution. Hence, option C is the correct answer.

Compare and contrast the characters of Rowan and Citra up to this point in the book. How do their character traits make either of them a better fit for being a scythe?

Answers

Answer:

The most notable difference that I remember between Rowan and Citra is that Rowan seemed more absolutely determined, while Citra seemed to carry some determination, albeit with compassion more prominent.  This brings into question the idea of worthiness for being a Scythe - since a Scythe is able to kill people at a whim with no repercussions, perhaps even with praise, should one value compassion or absolute unbiased determination?  Objectively, Rowan is better fit - he is more determined and able to take lives due to his nature.  This will be seen later on in the book if you read what happens to him in the future.  However, as compassion is needed when interacting with others, especially given a difficult idea such as killing, Citra may be a better fit, as she can be empathetic to those who are in the position of being gleaned.

TL;DR: It depends on your point of view.  Both are good candidates, as Faraday asserts simply by choosing them to be his apprentices.

extrinsic motivation is

Answers

Answer:

Extrinsic motivation is reward-driven behavior. It's a type of operant conditioning. ... In extrinsic motivation, rewards or other incentives — like praise, fame, or money — are used as motivation for specific activities. Unlike intrinsic motivation, external factors drive this form of motivation.

Explanation: :)

Answer:

i think its motivation that comes from the outside

Explanation:

edge 2021

is the term 'carpe diem' still relevant in today's culture? If so, where? Do you see it in current music, movies, etc?

Answers

Answer: See explanation

Explanation:

Carpe Diem is a Latin word that simply means that on should enjoy or sieze the moment. The word denotes that one should think less about what'll happen in the future but rather enjoy the moment presently.

It's still relevant in today's lecture. Recently, a musician named Olamide had an album titled "Carpe Diem". Also, there was a movie released that was tilted Carpe Diem as well. Both depicts that people should enjoy their lives and live their best moments.

Read the following sentence for practice fluency. Identify the correct syllable structure for the underlined word in the sentence.

The main goal was to preventing the practice of feeding dead ruminants to other ruminants.
a.
rum-i-nant
c.
ru-mi-nant
b.
ruminant
d.
ru-minant

Answers

Answer:

A. rum-i-nant or C. ru-mi-nant

Explanation:

Either A or C is correct.

Answer:

c

Explanation:

A song that tells a story, often using simple, folksy language.

Answers

Answer: A ballad?

Explanation:

Answer:

I think it would be Folk songs

Explanation:

"While candy is tasty, it gives me a stomach ache." Is this a simple, compound, or complex sentence?

Answers

Answer: complex sentence

Explanation:

A complex sentence is A simple sentence in grammar has only one main or independent clause and no dependent or subordinate clauses.

The sentence given only has one main clause, so it’s a complex sentence

What are the important features of literary analysis?

Answers

Answer:

The elements that make up a literary work are closely examined for their meaning and significance. Some of these elements are theme, character, and plot. Regardless of what aspect you choose to discuss, your analysis will focus on one controlling idea that, if writing, can be stated in one direct sentence.

Explanation:  

Find a favorite quote by Martin Luther King, Jr. and write an essay (3 paragraphs) about how you can and will apply his wisdom to your life as an entrepreneur

Answers

Answer:

A favorite quote by Martin Luther King, Jr. is written below in form of essay.

Explanation:

Reverend Martin Luther King, Jr. co-wrote his "I Have a Dream" expression with his intimate adviser Clarence Jones.

This is the view of the narrative that Clarence had put that was the backward the views of the address that had transformed the attitude of the people on the whole campaign.

The essay is written graphically and has a powerful worldly sense as it prevents towards the moment of honesty which is the address to build to it.

Another question for Edge 2020 Guys!

Answers

Answer:

yup 3 and 5

Explanation:

Douglass's tone in this passage is ?
A) angry
B) informative
C) lighthearted
D) melancholy​

Answers

Answer:

B

Explanation:

Douglass's tone in this passage is informative. The correct option is B.

What type is informative speech?

An informative speech provides objective, factual information regarding a subject, individual, event, or idea. The objective is to inform the audience without expressing an opinion, passing judgment, or trying to influence their attitude. The goal of the informative speech should be to educate the audience on a non-controversial subject.

A tone that is informative aims to educate the reader on a particular subject or topic. An informative tone is common in educational materials. Expository writing clarifies, informs, or describes. Because the primary goal is to convey factual information, including observations and personal/others' experiences, rather than to tell a story or convince readers of something, this type of writing is also referred to as the informative mode.

Thus, the ideal selection is option B.

Learn more about informative tone here:

https://brainly.com/question/28463414

#SPJ6

which version best uses a variety of sentence structures to enhance the flow and writing style of a story

Answers

Answer:

Seems like the answer would be C.

Explanation:

because I'm smarty pants

Answer:

d

Explanation:

Which statement best describes how figurative language contributes to the tone of the text? Help plz!

Answers

Answer:

I'd personally go with B.

Explanation:

B states that the "shuddering" flowers gave a wistful tone. Wistful, by definition, means "vague or regretful longing." Basically, similar to a melancholy tone.

can someone help me plsss

Answers

how can we give answer dear

because we don't know about this chapter ..what is in this ch.... u had read it so u can give perfect answer dear

what’s the story for this question??

Read this introduction to an argumentative essay about government. An effective system of government protects its citizens. The purpose of government is to ensure the safety of the nation and its residents. While other concerns such as economic growth are important, a government’s primary duty is to keep its people safe. Without the concern of defense or self-protection, individuals are able to live in security. Which sentence states the main argument of the essay?

Answers

Answer:

While other concerns such as economic growth are important, a government’s primary duty is to keep its people safe.

Explanation:

The argument shown in the question above reinforces the government's responsibility to maintain the safety of its population, putting as its main argument the fact that population security must be the main objective of the government and must be considered more important than any other, more important than , even the country's economic growth.

Answer:

the second sentence

Explanation:

Read this introduction to an argumentative essay about government.

An effective system of government protects its citizens. The purpose of government is to ensure the safety of the nation and its residents. While other concerns such as economic growth are important, a government’s primary duty is to keep its people safe. Without the concern of defense or self-protection, individuals are able to live in security.

Which sentence states the main argument of the essay?

the first sentence

the second sentence

the third sentence

the fourth sentence

Which words BEST describe the Nurse?(from Romeo and Juliet)

Answers

She is sincere, loyal, warm, loving, and even sort of funny. You didn’t put the answer choices but yea hope this helps

The author makes his argument that Marconi should have been given the patent by

Answers

Answer:

nobody

Explanation:

Answer:

WHAT ?

Explanation:

PLEASE HELP ME ASAP!!!!!
Give an example of a time when you watched a movie, listened to a poem or song, or read literature that changed your opinion or made you learn something new.

Answers

Answer:

We asked readers to pick a book that influenced how they think, act or look at the world. ... And for some, one book led to a lifelong love of the written word. ... My error the first time around was to read “Middlemarch” as one would a ... It made me realize how a beautiful, full life could be lived by virtue of the

Explanation:

Answer:

this is actually something you should write on your own

Explanation:

i would suggest you to write it by yourself but ill tell you something that happened to me when i heard the song scars to your beautiful by alessia cara it changed by way toward other people.they are human beings and need respect like us

Plzzzzzzzz help me!! Due today!! Will give the brainliest for the correct answer!!

The prompt asks you to analyze how the author's experience tght her a lesson about being proud of her Chinese heritage. So as you read, you should have been paying mention to the details about how the author feels separate or different. The chart below lists some details from these two paragraphs. Fill out the remaining boxes of the chart to analyze how these details reveal the author's feelings.

Answers

Answer:

Row 2 Column 2: Thinks their Christmas is weird, gross and shabby.

Row 3 Column 2: How the author views her relatives, and what she thinks of their manners compared to Americans.

Row 3 Column 3: Is ashamed of her family

Row 4 Column 2: How bad chinese food is compared to traditional american food

Row 4 Column 3: Is nervous about how the boy will react to a different cultured food.

Through her descriptions of shame, disappointment, and fear, the author reveals that she does not like her family heritage and is scared the boy will think less of her.

please urgent please help

Answers

Answer:

I cook awfully, I dance awfully, I draw ok, and I walk amazingly lol

Explanation:

Select the correct answer.
Which statement best describes Thomas Paine's use of evidence in the passage?
OA.
Paine used empirical evidence to support the claim that the Continental Army had performed creditably.
Paine used empirical evidence to support his claim that Howe's Army had decisively defeated the
Continental Army.
Paine used anecdotal evidence to support his claim that the Continental Army had performed creditably.
Paine used anecdotal evidence to support his claim that Howe's Army had decisively defeated the
Continental Army.
OB.
OC.
OD.

Answers

Oh yeah lol I did it on yesterday

Write a complete sentence that includes joining two main clauses.

Answers

Answer:

I am the cat and hes the man that I am.

Answer:

While Tom reads novels, Jack reads comics, but Sam only reads magazines

              ^                                        ^                                           ^

(Dependent Clause)      (Independent Clause)        (Independent Clause)

Read this excerpt from Night by Elie Wiesel.

Then the train resumed its journey, leaving in its wake, in a snowy field in Poland, hundreds of naked orphans without a tomb.

What does the image in this excerpt refer to?

the fact that the burial grounds in Poland are already full

the Polish children who no longer have parents

the train’s route through a snowy cemetery

the many abandoned bodies that cannot be buried

Answers

The answer is “The many abandoned bodies that cannot be buried” The reason for this is because the book is about the Holocaust and since they would kill them in such a vast amount and since they didn’t care for them they would just pile up the bodies.

how are the amendments of the bill of rights organized

Answers

Answer:

The amendments in the Bill of Rights are organized in order from one to ten.

Explanation:

HELP ME!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

Sorry

Explanation:

Sorry

i would have to say that A would be your answer

How would the author best respond to a counterclaim that dinomatron is made by the same company that created a holiday toy shortage the previous year

Answers

Hello. You forgot to enter the answer options. The options are:

A. By pointing out the lack of severe weather during the previous year's holiday season

B. By suggesting that this company simply releases great toys that everyone wants

C. By explaining how the Dinomatron toy is different from last year's popular toy

D. By including a quote from someone who was unable to purchase a Dinomatron toy

Answer:

B. By suggesting that this company simply releases great toys that everyone wants

Explanation:

To answer the counter-claim that the company that created Dinomatron caused the scarcity of toys, older ones, the speaker could say that the emergence of a company and a new toy does not have the power to finish the production of the other toys , but quality and innovation do. That's because the dinomatron company created quality, innovative and fun toys that made all children want for them. This reduced the demand for toys from other companies that could not keep up with the quality and ended up stopping their production.

Answer:

B is the final answer

Explanation:

Who is Mustafizur Rahman ?

Answers

Answer:

Mustafizur Rahman (born 6 September 1995) is a Bangladeshi international cricketer. He is specialized as a left-arm fast-medium bowler. He has taken the most wickets (13) in a debut One Day International (ODI) series. He is the first player to win the ‘Man of the Match’ award on both Test as well as ODI debuts.

Answer:

left-arm fast bowler

Mustafizur Rahman is a left-arm fast bowler and he plays for Bangladesh National Cricket Team. He recently started his International Cricket career but this few times, Mustafizur established himself as a famous Bowler in the world.

Explanation:

Please help! I will make you brainliest! (This question is from: The Dinner Party)
Why do the guests believe the colonel's argument was right?

Answers

The Dinner Party is a fictional short story written by Mona Gardner. In India, a colonial officer and his wife host a dinner party and invite army officers and government attaches along with their wives, and an American naturalist. A spirited discussion sparks up between a young girl and the colonel, in which the girl believes that woman have outgrown the fright-from-seeing-a-mouse era, but the colonel denies that and says that men have more control than women in every situation. Then, the American notices that the hostess is very still and summons a native boy over to her, who then leaves the room in a hurry and places a bowl of milk on the veranda outside of the room. Knowing at that point that there is a cobra under the table, he creates a game for the guests to see who has control by staying still for three hundred seconds. When he starts counting down the last twenty seconds to finish the game, the cobra emerges from under the table, going towards the bowl of milk outside, and the American locks it out of the room. After the ordeal, the American asks the hostess, Mrs. Wynnes, how she knew that the cobra was in the room, and she replies with, "because it was crawling across my foot."

Characters

There are a few characters in this short story. These characters are:

The American naturalist; is the one who knew that there was a cobra in the room and made up the game to keep the guests from getting bitten by the cobra.

The colonial officer (Mr. Wynnes); is the host of the dinner party and opposes the young girl's statement, saying that men have more control then women.

Mrs. Wynnes (the hostess); is the one who demonstrated that women can have the same amount of control as men when the cobra crawled across her foot.

Lastly, the young girl; is the one who brought up the conversation of women's control.

Setting

The setting of this story takes place in India (states it in the first sentence), in the late evening/night (takes place during dinnertime), and takes place in the early 1900's (they had a servant who was a young boy).

Conflict

The conflict of this story is that there is a cobra (antagonist) in the dinner room, which no one is aware of. So, the American must devise a way to keep all of the guests calm and still so that the cobra does not bite any of them, while also trying to get the cobra to go to the bowl of milk outside on the veranda.

Conclusion

The conclusion to this story is that while all of the guests were playing the American's game, when the American started to count down the final twenty seconds, the cobra comes out from under the dinner table, goes to the bowl of milk on the veranda, and the American locks it out of the room.

Irony

Within this story, the author used situational irony (When what happens is different from what was expected). She does this by opposing what the colonel said, which was that men have an ounce more of control in any situation than women, so when Mrs. Wynnes told the American that the cobra crawled across her foot, it showed that women can have as much control as men in the same situation, opposing the colonel's statement.

Theme

The theme of this story is control in situations of both men and women. This story tells us that in every situation we are placed in, we must take control of it and make the best of it.

Hope it help u..

Please make me brainlist if u like it..

45 points ppppppppppppppllllllllllllllllllllllllllllllllllllllllzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz help

Answers

A is the right answer I think

The Notorious jumping frog of calaveras country

Answers

Answer:

3t2yj0123tyjy5

t1d5j1ty531djdt51

53j153y1j3

Explanation:

Other Questions
Which of the following is NOT a possible verdict following jury deliberations?A.guiltyB.not guiltyC.delayed decisionD.hung jury PLEASE ANSWER< WILL GIVE BRAINLY TO BEST ANSWER!? NEED HELP FAST PLEASEEE!! What is greater than 4.026 Solve the following quadratic equation by rearranging and then factorising x^2 + 7x + 19 = 9 If the original quantity is 8 and the new quantity is ,2 what is the percent decrease? The Venn diagram below shows some of the services provided by national and state governments.Which service completes the Venn diagram? (3 points)A. Raise and collect taxesB. Declare war and make peaceC. Make marriage lawsD, Coin and print money Solve: 68 x = 14 ( please i really need these super fast thank you! ) happy new year. eeeeeeeee e I need help ASAP please Which sentence is best structured to present two ideas of equal importance?A. Since NASA was founded, it has sent more than 250 astronautsinto space.B. The mission of NASA is to explore outer space.C. Some people think that NASA should focus on exploring theuniverse, but others believe that building a colony on the moon isthe most important goal, even though it will be difficult.D. NASA is known for sending humans to the moon, but the famousspace program has also sent an unmanned spaceship to Mars. DETERMINE THE MISSING SIDE Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What caused the original creation of the Universe? How do we find out? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia List two equivalent numbers to 0.50