Explain the lifecycle of mosquito in short
Answer:
Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)
Can someone please help me on this plz I beg u :(
Answer:
Coleoptera is correct! Hope this helps.
explain how at least three pieces of evidence support the theory of evolution.
Dont put any link or else I won’t give brainlist, just answer.
Answer:
1. Fossil evidence
2. Homologous similarities.
3. Molecular evidence
Carbon dioxide enters a plant through pores (openings) called the
A. stomata.
B. cuticle.
C. veins.
why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.
Which process begins the formation of sedimentary rock?
what are the differences between ligaments & tendons
How is energy produced by respiration stored
Answer:
Explanation:
Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.
Answered by the ONE & Only #QUEEN aka #DRIPPQUEENMO
Hope this helped!!!
The energy that powers photosynthesis comes from
A. oxygen.
B. water.
C. the sun.
D. chemicals.
Answer:
sun but am not so sure about it
Which of the following best describes natural selection?
A. organisms vary in their physical traits, and some are inherited
B. Organisms compete for food and shelter
C. organisms best suited to their environments are most likely to survive and reproduce
D. Organisms produce more offspring than can survive
If an egg cell contains 4 chromosomes, how many chromosomes would a sperm cell of the same
species contain?
a. 4, b.8, c.16
tRNA uses (anticodons/codons) to match to the mRNA.
Answer:
anticodons
Explanation:
codons are for mRNA
tRNA uses anticodons to match to the mRNA.
Which one does tRNA uses?tRNA (transfer RNA) molecules are responsible for carrying specific amino acids to the ribosomes during protein synthesis.
They have an anticodon region that consists of three nucleotides that are complementary to the codons on the mRNA (messenger RNA). The codons on the mRNA determine the sequence of amino acids in the growing polypeptide chain.
The anticodon on the tRNA base pairs with the complementary codon on the mRNA, ensuring that the correct amino acid is incorporated into the growing protein chain. The matching between the anticodon and codon is essential for the accurate translation of genetic information into protein synthesis.
Learn more about tRNA at:
https://brainly.com/question/4089622
#SPJ6
I will mark Brainliest for frist answer
Answer:C, to contain the information
Explanation:
¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?
Answer:
La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:
What does a bioprospector do?
Answer:
bioprospecting. The analysis of plants, animals, insects and other organisms in an ecosystem with high biodiversity for therapeutic candidate molecules and substances.
Explanation:
Answer:
It does the analysis of plants, animals, insects and other organisms in an ecosystem with high biodiversity for therapeutic candidate molecules and substances.
Explanation:
what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?
Help please :) thank u
Answer:
!! neither mechanical nor chemical digestion
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?
Here's li[tex]^{}[/tex]nk to the answer:
bit.[tex]^{}[/tex]ly/3tZxaCQ
help................
The top left, would be light energy from the sun, while the top of the circle would be living beings. Think about it just like plants that that gain energy from the sun through photosynthesis. Then the bottom of the circle would be nonliving beings, either decomposed plants or animals that bring nutrients to soil, or dead ones that we eat. This cycles through until the energy is rereleased through heat. Therefore the top right would be heat energy, every living thing on earth creates gradual amounts of heat. Imagine going for a run, you'll probably be hotter afterwards right? I know it's not the most scientific answer but its 100% right.
Hope this helps!
Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.
_____ Motor neurons cause muscles to contract so the body can react to the stimulus.
_____ The brain processes the information through interneurons.
_____ Interneurons transfer response information to motor neurons.
_____ Sensory neurons carry stimulus information to the brain or spinal cord.
Answer:
The correct answer is -
1 - The stimulus is received by sensory receptors.
2 - Sensory neurons carry stimulus information to the brain or spinal cord.
3 - The brain processes the information through interneurons.
4 - Interneurons transfer response information to motor neurons.
5 - Motor neurons cause muscles to contract so the body can react to the stimulus.
Explanation:
In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.
These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.
HELPPP PLEASEEE
4 ANNOTATE Use the correct terms to complete this diagram showing the reactants and
products for each chemical reaction.
Answer:
Explanation:
Photosynthesis
Reactants: Carbon dioxide and water
Products: Glucose and oxygen
Respiration
It's the opposite of photosynthesis:
Reactants: glucose and oxygen
Products: Carbon dioxide and water
7. How does a beach mouse get its trait? The order of the process is:
A.RNA → Gene A → Protein A → Amino Acid → Fur color
B.Gene A → Amino Acid → Protein A → RNA → Fur color
C.Protein A → Amino Acid → RNA → Gene A →Fur color
D.Gene A → RNA → Amino Acid → Protein A → Fur color
E.RNA → Gene A → Amino Acid → Protein A → Fur color
Which two molecules are produced over the course of the light and dark reactions of photosynthesis?
glucose
water
carbon dioxide
pyruvic acid
oxygen
Earth's core is the source of the energy that drives the movement of tectonic plates. Which two processes help transfer this energy outward to earth's crust?
Answer:The two processes are CONDUCTION and CONVECTION
Explanation:
The Energy produced in the Earth core is generated by Sun, gravitational force , radioactive decay, and the Earth' rotation, To maintain balance in the earth, The processes of CONDUCTION and CONVECTION transfer energy (HEAT) to Earth's interior, which also helps the movement of tectonic plates at a constant rate.
Now, inside the earth mantle is made up of hot solid rock and because Conduction occurs more in solids, Its currents helps the continuous transfer of heat energy from the warmer mantle at the bottom to the cooler mantle at the top While Convection currents in the core move thermal energy causing the rising and sinking of warm and cooler molten rock inside Earth, thereby maintaining the motion of tectonic plates and creating a balance in the earth.
Answer:
Conduction and Convection
Explanation:
This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?
Answer:
Carbon dioxide, water and sunlight
Answer:
water and sunlight
Explanation:
Viruses can be prevented by receiving a weakened form of the virus called a?
A)plastid
B)vaccine
C)antibiotic
D)fertilizer
plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.
Which molecule is produced in the aerobic breakdown of a glucose molecule?
A. Water
B. Oxygen
C. Light
D. Alcohol
E. NADPH
[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]
E. NADPH
thankshope it helpspls mark as brainliestAnswer:
E
Explanation:
it enters the citric acid cycle and generates reducing equivalents in the form of NADPH
This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism
Answer:
A. Mutualism
Explanation:
The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.
