Which term refers to the energy an object has due to its position?

Answers

Answer 1

Answer:

Potential Energy.

Explanation:

Potential energy, stored energy that depends on different parts of the system's relative position. When compressed or stretched, spring has more potential energy.

A stainless steel ball has more energy than it had when it fell to the world. It is able to do more work in the raised position.

Potential energy is a system's property and not a single body or particle. The earth-consistent system and raised ball, for instance, have greater potential energy as the two are more distinct.


Related Questions

Water that is dense will float while water that is less dense will sink.
True or false ?

Answers

Answer:

If an object is more dense than water it will sink when placed in water, and if it is less dense than water it will float.

This is False it will sink

How does convection cause ocean currents?
A. During the process of convection, energy is transferred to the atmosphere forming winds. These winds power surface currents.
B. During the process of convection, the heating of surface water by the sun results in upwelling.
C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.
D. During the process of convection, more minerals and gases dissolve in warm water. This increases the density of the warm water and causes it to sink.

Answers

Answer:

C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.

Explanation:

Convection refers to the process of transference of heat from one place to another by the movement of gas/liquid particles. Convection occurs when a gas or liquid substance is heated, thereby it expands (increase its volume) by gaining kinetic energy and moving far apart. Energy in the atmosphere and oceans is transferred mainly by convection. In the atmosphere, convection produces wind belts. Moreover, an ocean current is the result of the continuous movement of seawater caused by different forces acting upon the water (i.e., wind, the Coriolis effect, waves, temperature). In the oceans, convection produces currents because the seawater heats up becoming less dense and moves above cooler seawater, emitting heat during the process and causing the continual circulation of water.

Answer:

c

Explanation:

What is photosynthesis ​

Answers

ANSWER:

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's metabolic activities.

CARRYONLEARNING(◕ᴗ◕✿)

photosynthesis is the process in which light energy is absorbed by chlorophyll and converted into chemical energy to form glucose

i need help with this question

Answers

Research Question: How does various water types affect the growth of plants?

Independent Variable: Type of water

Dependent variable: plant growth

Constants: Time period (2 weeks)

Controls: type of plant, amount of soil, etc (anything you want to remain constant throughout).

please help meeeeeeeeeee.

Answers

Answer:

T = A

A = U

G = C

A = U

A = U

C = G

draw any two microbes​

Answers

In the attachment are some examples:

Explain spermatogenesis and oogenesis.

Answers

Answer:

yep, my explanation

Explanation:

you see, it is a very dirty cycle, when you have a dioploid cell, you have your typical duplication of sister chromotids, but producing sex cells or gametes which would become a zygote through dirty interactions come to form one dioploid cell and it will start doubling like the rest of the human body, until it comes out of the other human's body. meiosis, or the formation of gamates are created with a crossover where one diolpoid cell takes one half of the chromosome and the other half and exchange a tiny bit of it before splitting into 2 DIFFERENT gametes cells because of the cross-over and hence ther term natural selection

The template strand for a new DNA molecule reads 5' CCTGAATT 3'. What will be the nitrogen base sequence for the complementary strand created during DNA replication?

Answers

Answer:

3' GGACTTAA 5'

Explanation:

because Adenine always pair with Thymine and Cytosine with guanine. u can also remember them as Apple Tree and Car Garage

Which of the following best represents the purpose of fertilizers?

Answers

Answer:

Fertilizer, natural or artificial substance containing the chemical elements that improve growth and productiveness of plants. Fertilizers enhance the natural fertility of the soil or replace the chemical elements taken from the soil by previous crops.

Which of the following best describes the function of the human nervous system? ​

Answers

Answer:

The nervous system gathers, interprets, and responds to information about the body's internal and external environment.

What does the prefix "hetero-" mean?
A. Same

B. Different

Answers

I would say different
Like you like different genders

Answer:

B. Different

Explanation:

Because it is ______ , fermentation _______ oxygen.



Answers:
aerobic/requires
anaerobic/requires
aerobic/does not require
anaerobic/does not require

Answers

Answer:

anaerobic/does not require

Explanation:

anaerobic occurs in the absence of oxygen

which process produce two genetically distinct haploid cells

Answers

Answer:  mitosis

Explanation:

Mr. and Mrs. Green have a daughter, Georgia, who was born at Riverside Community Hospital. Mr. and Mrs. Blue have a daughter, Belle, who was born on the same date at the same hospital. Mrs. Green, having recently seen Belle, is convinced that Belle and Georgia had been assigned to the wrong parents at the hospital. Mrs. Green thinks that Belle is her biological daughter. ABO blood analysis was performed on all individuals involved:Mr. Green: Type AMrs. Green: Type A Georgia: Type AMr. Blue: Type ABMrs. Blue: Type ABelle: Type O
Is Mrs. Green correct? Is Belle her biological daughter? Explain.

Answers

Answer:

Yes, Mrs Green is correct that Belle is her biological daughter

Explanation:

According to this question, Mr. and Mrs. Green is said to have a daughter, Georgia while Mr. and Mrs. Blue is said to have a daughter, Belle. Both daughters were born the same day. Hence, a controversy occured as Mrs. Green thinks that Belle is her biological daughter.

Based on the blood analysis, the following were obtained:

Mr. Green: Type A

Mrs. Green: Type A

Georgia: Type A

Mr. Blue: Type AB

Mrs. Blue: Type A

Belle: Type O

The genotype of the following blood types is as follows:

Type A - iAiA or iAi

Type B - iBiB or iBi

Type O - ii

Type AB - iAiB

From the analysis of blood types of Mr and Mrs Green, which are both type A, they can possibly produce a child with type A.

However, from the analysis of Mr. and Mrs. Blue, it is impossible to have a child with blood type O. However it is possible for Mr and Mrs. Green if they are both heterozygous (iAi × iAi). The punnet square is attached. Hence, Mrs Green is correct about her claim since Mr. and Mrs. Blue cannot have a child with blood type A.

write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond​

Answers

(See the attached picture)

Direction: Write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond.

Answer:

The goal of the sperms’ journey to the egg is to fertilize it. To do so, the sperm cell must pass through a long and challenging path. This is one of the reasons why the total number of motile sperm cells is very important, and a key parameter for a man’s potential to reach pregnancy with his partner.

The sperms’ journey to the egg begins with millions of sperm cells that are released into the female reproductive tract during intercourse. The sperm cells gain their full ability to swim when they are ejaculated into the reproductive tract.

Upon ejaculation, the sperm cells are enclosed in a fluid called seminal plasma or semen, which is a mix of fluids from the testes, seminal vesicles, prostate, and the bulbourethral glands. The fluid contains elements which protect the sperm cells during their journey towards the egg. The semen thickens and helps the sperm cells stay inside the woman – as close as possible to the cervix, which is the “gate” to the egg.

Liquid extends from the cervix, allowing the sperm cells from the semen to swim into the cervix. Only the strongest sperm cells will make it this far. Once through the cervix, the sperm cells swim across the uterus and into the fallopian tubes.

I hope it helps!!

The sperm cell fertilizes the egg and forms a zygote, which is further divided into multiple cells and becomes a child. The division is the process of mitosis that takes place from the zygote to the child's development.

How is the zygote formed and developed?

The sperm and the ovum are produced by the process of meiosis from the male and female, respectively, and when both fertilize, the zygote is formed. The fertilized zygote is a single cell, but later that cell is further divided mitotically and forms a morula, then a blastula, and then the gastrula.

The cells of the gastrula undergo cell differentiation, different organs are developed, and the baby is finally formed. The child then continues to grow in size, and different organs grow and form the mature organ system. After a certain age, the reproductive organs start to mature and are capable of forming the gametes.

Hence, all of these events occurred from the zygote to the child's maturity.

Learn more about the zygote here.

https://brainly.com/question/465851

#SPJ2

Which of the following best describes the producers in a terrestrial food web?

A) They are at the top of the energy pyramid.
B) They obtain their energy from consumers.
C) They are unaffected by decomposers.
D) They convert energy from the sun to chemical energy.

Answers

Answer:

The correct answer is - D. They convert energy from the sun to chemical energy.

Explanation:

In any food web, producers are the organism that can make their own food and energy by converting light energy coming from the sun into chemical energy, this process called photosynthesis.

Normally producers are green plants. These are present at the bottom of the energy pyramid as these are the highest in the number. Consumers et energy from producers by feed on them.

The male tubes that transport sperm from the testes are called?

Answers

Answer:

The epididymis is the tube that moves the sperm from the testicles.

Answer:

epididymis

Explanation:

Pls answer I will help you out. Need this for tmr​

Answers

Answer:

uhh

Explanation:

sorry i dont know

99% of the GMOs on the planet are ____
or ____

Answers

Answer:

The answer would be pesticide producers and herbicide resisters.

Explanation:

Hope this helped!

How many amino acids must be obtained in the diet because they cannot be made by the body?
2
5
10
20

Answers

amino acids we obtained in the diet about 10

If earth’s atmosphere is made up of 78% nitrogen, why is nitrogen a limiting factor for producers?
A.
Consumers respire all of the available nitrogen.

B.
Nitrogen is unusable in its liquid form.

C.
There are more plants than gaseous nitrogen.

D.
Nitrogen is unusable in its gaseous form.

Answers

d is the answerrrrrrrrrr

Give 2 advantages that mammals have over reptiles. Explain.

Answers

Answer:

warm-bloodedness is the main one

Explanation:

Answer:

1) Being warm-blooded gives mammals a distinct advantage in habitats

2) Mammals are important members of food chains and food webs, as grazers and predators.

3) Mammals meet people's needs by serving as pets, transport, food, or research subjects.

4) Mammals also interact with other species in many symbiotic relationships.

Which of the following is a subsystem of an organism?Please explain and I give you 5 stars.
A.cell
B.organ system
C.tissue
D.all of the above

Answers

Answer:

D

Explanation:

In multicellular organisms, the body is a system of multiple, interacting subsystems. Subsystems are groups of cells that work together to form tissues. Interactions are limited to the circulatory, excretory, digestive, respiratory, muscular, and nervous systems.

D. All of the above

Suggest one other use of glucose in a potato plant that's still growing below ground

Answers

Answer:

glucose is used to make cell walls, make protein amd stored as starch.

Hi, I don’t know what the other uses were in the question for which you can’t use but I have a couple.

> Produce respiration
> Store starch underground, so I knew plant can grow
> Glucose which is soluble is converted into insoluble starch for storage

Hope this helps :)

What is an amino acid

Answers

Amino acids are organic compounds that contain amino and carboxyl functional groups, along with a side chain specific to each amino acid. Hope this helps!!<3

Answer:

i dont know

Explanation:

bgggfbjn

Hi I need help with #1 that is shown in the image below. Pls answer and give me a explanation.

Answers

it’s option 3, both types of cells need energy to carry out their functions

The owner of a white female poodle wants her dog to have white puppies. she takes her dog to a breeder, who tells her he will mate her poodle with a white male. Much to the owner's surprise, her poodle gives birth to a black male instead of a white one. she is suing the breeder, alleging he mated her poodle with a black male instead of a white one, which resulted in six unwanted black puppies. You know that the white hair allele is recessive to the dominant allele for black hair in poodles. would you support the owner's allegation? explain your answer.

Answers

The black gene is more common

Name two traits that the most recent common ancestor of a whale and a human probably had.

Answers

Answer:

Their ancestor is most likely an ancient artiodactyl, i.e. a four-legged, even-toed hoofed ... However, whales, like humans, are mammals.

Explanation:

hope it help u

Write mechanism of absorption​

Answers

Answer: The mechanism for absorption is that a photon transfers all its energy to an electron in the absorbing material. The photon is "lost" from the light beam as it is absorbed in a single event. The electron is excited by the gain in energy to a higher energy state in the electron configuration around the atom. (hope it helps)

Answer: I don't know

Explanation: i am brainless

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

Other Questions
From A Streetcar Named Desire What kinds of literary techniques does this scene use? Determine how much sulfuric acid (in metric tons) is produced by the combustion of 1.2 metric ton of this coal. (A metric ton is 1000 kg.) (310)+(610)+(910)+(710)+(810) is the same as ______ (a)34697 (b)36978 (c)306978 (d)3006978 Will give BRAINLIST, Read the excerpt from "A Quilt of a Country."Today the citizens of the United States have come together once more because of armed conflict and enemy attack. Terrorism has led to devastationand unity.Which statement best explains the role context plays in better understanding this excerpt?Knowing that Quindlen has an Italian and Irish heritage helps the reader better understand her viewpoint, which is that all immigrants are the same.Knowing that Quindlen compares the American people to a quilt helps the reader better understand her viewpoint of America as a melting pot.Knowing that Quindlen lives in New York helps the reader understand that she lives in a multicultural environment.Knowing that Quindlen wrote this piece after the 9/11 attacks helps readers understand her viewpoint, which is that tragedy unites people. The angles shown below are supplementary:what is the value of x True or False: After the Bonus Army demonstrated around the Capitol and lobbied senators, the Senate passed the bonus bill. Read this sentence fragment. With love. Identify the choice that corrects this sentence fragment? A) with immense love and great care B) Terese did small things with loveC) tried to do things with loveD) with love from the heart How does Gettysburg affect American History by 3 examples?Will give Brainlist! Translate to an algebraic expression. The difference of five times a number and two Describe two things you should consider as youre planning a story. hola como estan soy nueva 9. What was the alliance of western countries against communism called?a. The Warsaw Pactb. NATOC. The Central Powersd. The Allied Powers Read this excerpt from "Look Homeward, Angel."And whatever he touched in that rich fortress of his soul sprang into golden life: as the years passed, the fruit treesthe peach, the plum, the cherry, the applegrew great and bent beneath their clusters. His grape vines thickened into brawny ropes of brown and coiled down the high wire fences of his lot, and hung in a dense fabric, upon his trellises, roping his domain twice around. They climbed the porch end of the house and framed the upper windows in thick bowers. And the flowers grew in rioting glory in his yardthe velvet-leaved nasturtium, slashed with a hundred tawny dyes, the rose, the snowball, the redcupped tulip, and the lily.The author uses sensory details in this excerpt to create images ofa) excess and riches, to suggest Gants interest in materialism.b) shades and barriers, to suggest Gants need for privacy.c) colorful sceneries, to suggest Gants artistic aptitude.d) bountiful harvests, to suggest Gants agricultural success. What is the radius of a circular swimming pool with a diameter of 20 feet? Read the excerpt from Silent Spring.In the gutters under the eaves and between the shingles of the roofs, a white granular powder still showed a few patches; some weeks before it had fallen like snow upon the roofs and the lawns, the fields and streams.Which best explains how the phrase white granular powder supports the authors purpose of calling attention to the environment?The powder is an unnatural substance.The powder has a texture like sugar.The powder looks like freshly fallen snow.The powder is used in house construction. Help me plzzzzzz and give steps plzz Once the actions of a person involved in a bias incident began to escalate, do you think its difficult to stop? Why or why not? TERCER TRIMESTRE SEGUNDO GRADODEL 7 DE JUNIO AL 18 DE JUNIO4- Calcular la media, la mediana y la moda de la siguiente serie de numeros: 5, 3, 6, 5, 4, 5, 2, 8, 6,5,4,8,3,4,5,4,8,25.4. A cylindrical space capsule lands in the ocean. This capsule is 2.44 m long, 1.10 m in diameter, and weighted at one end so that it floats with its long central axis vertical and 0.820 m of its length above the water surface. The mass density of sea water is 1025 kg/m3.What is the magnitude of the buoyant force exerted on the capsule?